Human Cd24/CD24A ORF/cDNA clone-Lentivirus particle (NM_001291739)
Cat. No.: vGMLP004763
Pre-made Human Cd24/CD24A Lentiviral expression plasmid for Cd24 lentivirus packaging, Cd24 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CD24/Cd24/CD24A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004763 | Human Cd24 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004763 |
| Gene Name | Cd24 |
| Accession Number | NM_001291739 |
| Gene ID | 100133941 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 390 bp |
| Gene Alias | CD24A |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGTGGGACGATTCTGTCCCGAGTCCCCGCCAGGCTTTGTTCGGGTCGCCGCTACCAGCGCGGTCTCCCTAGATCCTCCATCCGGGGAACCTCGCCCCGGGTGCGGGTACCCGGGGCCGCGCAGCGCTGCCTCGAGGGTGTATGGATGCACCGCGCCGGCGAGAGAGACCGGGGGCTGGGCCTGGGAGACCCTAGCGGGGGCGGGGGCGAAGAAGATTTATTCCAGTGAAACAACAACTGGAACTTCAAGTAACTCCTCCCAGAGTACTTCCAACTCTGGGTTGGCCCCAAATCCAACTAATGCCACCACCAAGGCGGCTGGTGGTGCCCTGCAGTCAACAGCCAGTCTCTTCGTGGTCTCACTCTCTCTTCTGCATCTCTACTCTTAA |
| ORF Protein Sequence | MVGRFCPESPPGFVRVAATSAVSLDPPSGEPRPGCGYPGPRSAASRVYGCTAPARETGGWAWETLAGAGAKKIYSSETTTGTSSNSSQSTSNSGLAPNPTNATTKAAGGALQSTASLFVVSLSLLHLYS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T65906-Ab | Anti-CD24/ CD24A functional antibody |
| Target Antigen | GM-Tg-g-T65906-Ag | CD24 protein |
| ORF Viral Vector | pGMLP004763 | Human Cd24 Lentivirus plasmid |
| ORF Viral Vector | vGMLP004763 | Human Cd24 Lentivirus particle |
Target information
| Target ID | GM-T65906 |
| Target Name | CD24 |
| Gene ID | 100133941, 12484, 25145, 102155900, 767920 |
| Gene Symbol and Synonyms | CD24,CD24A,HSA,Ly-52,nectadrin |
| Uniprot Accession | P25063 |
| Uniprot Entry Name | CD24_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target |
| Disease | Prostate Cancer |
| Gene Ensembl | ENSG00000272398 |
| Target Classification | Not Available |
This gene encodes a sialoglycoprotein that is expressed on mature granulocytes and B cells and modulates growth and differentiation signals to these cells. The precursor protein is cleaved to a short 32 amino acid mature peptide which is anchored via a glycosyl phosphatidylinositol (GPI) link to the cell surface. This gene was missing from previous genome assemblies, but is properly located on chromosome 6. Non-transcribed pseudogenes have been designated on chromosomes 1, 15, 20, and Y. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


