Human Cd24/CD24A ORF/cDNA clone-Lentivirus particle (NM_001291739)

Cat. No.: vGMLP004763

Pre-made Human Cd24/CD24A Lentiviral expression plasmid for Cd24 lentivirus packaging, Cd24 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CD24/Cd24/CD24A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004763 Human Cd24 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004763
Gene Name Cd24
Accession Number NM_001291739
Gene ID 100133941
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 390 bp
Gene Alias CD24A
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTGGGACGATTCTGTCCCGAGTCCCCGCCAGGCTTTGTTCGGGTCGCCGCTACCAGCGCGGTCTCCCTAGATCCTCCATCCGGGGAACCTCGCCCCGGGTGCGGGTACCCGGGGCCGCGCAGCGCTGCCTCGAGGGTGTATGGATGCACCGCGCCGGCGAGAGAGACCGGGGGCTGGGCCTGGGAGACCCTAGCGGGGGCGGGGGCGAAGAAGATTTATTCCAGTGAAACAACAACTGGAACTTCAAGTAACTCCTCCCAGAGTACTTCCAACTCTGGGTTGGCCCCAAATCCAACTAATGCCACCACCAAGGCGGCTGGTGGTGCCCTGCAGTCAACAGCCAGTCTCTTCGTGGTCTCACTCTCTCTTCTGCATCTCTACTCTTAA
ORF Protein Sequence MVGRFCPESPPGFVRVAATSAVSLDPPSGEPRPGCGYPGPRSAASRVYGCTAPARETGGWAWETLAGAGAKKIYSSETTTGTSSNSSQSTSNSGLAPNPTNATTKAAGGALQSTASLFVVSLSLLHLYS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T65906-Ab Anti-CD24/ CD24A functional antibody
    Target Antigen GM-Tg-g-T65906-Ag CD24 protein
    ORF Viral Vector pGMLP004763 Human Cd24 Lentivirus plasmid
    ORF Viral Vector vGMLP004763 Human Cd24 Lentivirus particle


    Target information

    Target ID GM-T65906
    Target Name CD24
    Gene ID 100133941, 12484, 25145, 102155900, 767920
    Gene Symbol and Synonyms CD24,CD24A,HSA,Ly-52,nectadrin
    Uniprot Accession P25063
    Uniprot Entry Name CD24_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000272398
    Target Classification Not Available

    This gene encodes a sialoglycoprotein that is expressed on mature granulocytes and B cells and modulates growth and differentiation signals to these cells. The precursor protein is cleaved to a short 32 amino acid mature peptide which is anchored via a glycosyl phosphatidylinositol (GPI) link to the cell surface. This gene was missing from previous genome assemblies, but is properly located on chromosome 6. Non-transcribed pseudogenes have been designated on chromosomes 1, 15, 20, and Y. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.