Human DMRT2 ORF/cDNA clone-Lentivirus particle (NM_001130865)

Cat. No.: vGMLP004792

Pre-made Human DMRT2/ Lentiviral expression plasmid for DMRT2 lentivirus packaging, DMRT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to DMRT2/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004792 Human DMRT2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004792
Gene Name DMRT2
Accession Number NM_001130865
Gene ID 10655
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 681 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCGACCCGCAGGCTGGCTCCGCGGCCGGGGACTGGGAGATCGATGTCGAGAGCCTGGAGCTGGAAGAGGACGTCTGCGGGGCGCCGCGGTCCACGCCCCCCGGGCCCAGCCCGCCGCCGGCGGACGGGGACTGCGAGGACGACGAAGATGACGACGGGGTGGACGAAGACGCGGAAGAAGAGGGCGACGGCGAGGAGGCAGGCGCGTCCCCCGGGATGCCCGGCCAGCCGGAGCAGCGGGGGGGACCGCAGCCGAGGCCGCCGCTCGCGCCTCAGGCCTCACCCGCCGGCACCGGTCCCCGAGAGCGCTGCACTCCCGCGGGCGGCGGCGCGGAGCCGCGCAAGCTGAGCCGCACGCCCAAGTGCGCGCGCTGCCGCAACCACGGCGTGGTGTCCTGCCTGAAGGGCCACAAGCGCTTCTGTCGCTGGCGCGACTGCCAGTGCGCCAACTGCCTGCTGGTGGTGGAGCGGCAGCGCGTCATGGCCGCCCAGGTGGCGCTCCGGAGGCAGCAGGCCACCGAGGACAAGAAGGGGCTTTCCGGGAAACAGAATAATTTCGAGCGCAAAGCTGTGTACCAGAGGCAAGTCAGAGCCCCCAGTTTGCTGGCCAAAAGCATTTTAGAAGTTCTCCTTGGATTATTCTACAGCTATTATGTGTACATAATGAACCATCTTTAG
ORF Protein Sequence MADPQAGSAAGDWEIDVESLELEEDVCGAPRSTPPGPSPPPADGDCEDDEDDDGVDEDAEEEGDGEEAGASPGMPGQPEQRGGPQPRPPLAPQASPAGTGPRERCTPAGGGAEPRKLSRTPKCARCRNHGVVSCLKGHKRFCRWRDCQCANCLLVVERQRVMAAQVALRRQQATEDKKGLSGKQNNFERKAVYQRQVRAPSLLAKSILEVLLGLFYSYYVYIMNHL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0698-Ab Anti-DMRT2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0698-Ag DMRT2 protein
    ORF Viral Vector pGMLP004792 Human DMRT2 Lentivirus plasmid
    ORF Viral Vector vGMLP004792 Human DMRT2 Lentivirus particle


    Target information

    Target ID GM-IP0698
    Target Name DMRT2
    Gene ID 10655, 226049, 697088, 309430, 101083374, 106559228, 514435, 100057779
    Gene Symbol and Synonyms DMRT2,DSXL-2,Terra
    Uniprot Accession Q9Y5R5
    Uniprot Entry Name DMRT2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000173253
    Target Classification Not Available

    The protein encoded by this gene belongs to the DMRT gene family, sharing a DM DNA-binding domain with Drosophila 'doublesex' (dsx) and C. elegans mab3, genes involved in sex determination in these organisms. Also, this gene is located in a region of the human genome (chromosome 9p24.3) associated with gonadal dysgenesis and XY sex reversal. Hence this gene is one of the candidates for sex-determining gene(s) on chr 9. [provided by RefSeq, Apr 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.