Human DMRT2 ORF/cDNA clone-Lentivirus particle (NM_001130865)
Cat. No.: vGMLP004792
Pre-made Human DMRT2/ Lentiviral expression plasmid for DMRT2 lentivirus packaging, DMRT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
DMRT2/ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004792 | Human DMRT2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004792 |
| Gene Name | DMRT2 |
| Accession Number | NM_001130865 |
| Gene ID | 10655 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 681 bp |
| Gene Alias | |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCGACCCGCAGGCTGGCTCCGCGGCCGGGGACTGGGAGATCGATGTCGAGAGCCTGGAGCTGGAAGAGGACGTCTGCGGGGCGCCGCGGTCCACGCCCCCCGGGCCCAGCCCGCCGCCGGCGGACGGGGACTGCGAGGACGACGAAGATGACGACGGGGTGGACGAAGACGCGGAAGAAGAGGGCGACGGCGAGGAGGCAGGCGCGTCCCCCGGGATGCCCGGCCAGCCGGAGCAGCGGGGGGGACCGCAGCCGAGGCCGCCGCTCGCGCCTCAGGCCTCACCCGCCGGCACCGGTCCCCGAGAGCGCTGCACTCCCGCGGGCGGCGGCGCGGAGCCGCGCAAGCTGAGCCGCACGCCCAAGTGCGCGCGCTGCCGCAACCACGGCGTGGTGTCCTGCCTGAAGGGCCACAAGCGCTTCTGTCGCTGGCGCGACTGCCAGTGCGCCAACTGCCTGCTGGTGGTGGAGCGGCAGCGCGTCATGGCCGCCCAGGTGGCGCTCCGGAGGCAGCAGGCCACCGAGGACAAGAAGGGGCTTTCCGGGAAACAGAATAATTTCGAGCGCAAAGCTGTGTACCAGAGGCAAGTCAGAGCCCCCAGTTTGCTGGCCAAAAGCATTTTAGAAGTTCTCCTTGGATTATTCTACAGCTATTATGTGTACATAATGAACCATCTTTAG |
| ORF Protein Sequence | MADPQAGSAAGDWEIDVESLELEEDVCGAPRSTPPGPSPPPADGDCEDDEDDDGVDEDAEEEGDGEEAGASPGMPGQPEQRGGPQPRPPLAPQASPAGTGPRERCTPAGGGAEPRKLSRTPKCARCRNHGVVSCLKGHKRFCRWRDCQCANCLLVVERQRVMAAQVALRRQQATEDKKGLSGKQNNFERKAVYQRQVRAPSLLAKSILEVLLGLFYSYYVYIMNHL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP0698-Ab | Anti-DMRT2 monoclonal antibody |
| Target Antigen | GM-Tg-g-IP0698-Ag | DMRT2 protein |
| ORF Viral Vector | pGMLP004792 | Human DMRT2 Lentivirus plasmid |
| ORF Viral Vector | vGMLP004792 | Human DMRT2 Lentivirus particle |
Target information
| Target ID | GM-IP0698 |
| Target Name | DMRT2 |
| Gene ID | 10655, 226049, 697088, 309430, 101083374, 106559228, 514435, 100057779 |
| Gene Symbol and Synonyms | DMRT2,DSXL-2,Terra |
| Uniprot Accession | Q9Y5R5 |
| Uniprot Entry Name | DMRT2_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000173253 |
| Target Classification | Not Available |
The protein encoded by this gene belongs to the DMRT gene family, sharing a DM DNA-binding domain with Drosophila 'doublesex' (dsx) and C. elegans mab3, genes involved in sex determination in these organisms. Also, this gene is located in a region of the human genome (chromosome 9p24.3) associated with gonadal dysgenesis and XY sex reversal. Hence this gene is one of the candidates for sex-determining gene(s) on chr 9. [provided by RefSeq, Apr 2010]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


