Human MGP/GIG36/MGLAP ORF/cDNA clone-Lentivirus particle (NM_001190839)
Cat. No.: vGMLP004798
Pre-made Human MGP/GIG36/MGLAP Lentiviral expression plasmid for MGP lentivirus packaging, MGP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
MGP/GIG36 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004798 | Human MGP Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004798 |
| Gene Name | MGP |
| Accession Number | NM_001190839 |
| Gene ID | 4256 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 387 bp |
| Gene Alias | GIG36,MGLAP,NTI |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAAGAGCCTGATCCTTCTTGCCATCCTGGCCGCCTTAGCGGTAGTAACTTTGTGTTATGGAGAGTGGCAGAAAGAAGAAAACTTCGGCTTTGATATCGTTTCAGTTCTCTCTCTGAACTGGCATCGTGCCCAGGAATCACATGAAAGCATGGAATCTTATGAACTTAATCCCTTCATTAACAGGAGAAATGCAAATACCTTCATATCCCCTCAGCAGAGATGGAGAGCTAAAGTCCAAGAGAGGATCCGAGAACGCTCTAAGCCTGTCCACGAGCTCAATAGGGAAGCCTGTGATGACTACAGACTTTGCGAACGCTACGCCATGGTTTATGGATACAATGCTGCCTATAATCGCTACTTCAGGAAGCGCCGAGGGACCAAATGA |
| ORF Protein Sequence | MKSLILLAILAALAVVTLCYGEWQKEENFGFDIVSVLSLNWHRAQESHESMESYELNPFINRRNANTFISPQQRWRAKVQERIRERSKPVHELNREACDDYRLCERYAMVYGYNAAYNRYFRKRRGTK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1099-Ab | Anti-MGP/ GIG36/ MGLAP functional antibody |
| Target Antigen | GM-Tg-g-SE1099-Ag | MGP protein |
| ORF Viral Vector | pGMLP004798 | Human MGP Lentivirus plasmid |
| ORF Viral Vector | vGMLP004798 | Human MGP Lentivirus particle |
Target information
| Target ID | GM-SE1099 |
| Target Name | MGP |
| Gene ID | 4256, 17313, 574116, 25333, 101096741, 100856382, 282660, 100063934 |
| Gene Symbol and Synonyms | GIG36,MGLAP,MGP,NTI |
| Uniprot Accession | P08493 |
| Uniprot Entry Name | MGP_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000111341 |
| Target Classification | Not Available |
This gene encodes a member of the osteocalcin/matrix Gla family of proteins. The encoded vitamin K-dependent protein is secreted by chondrocytes and vascular smooth muscle cells, and functions as a physiological inhibitor of ectopic tissue calcification. Carboxylation status of the encoded protein is associated with calcification of the vasculature in human patients with cardiovascular disease and calcification of the synovial membranes in osteoarthritis patients. Mutations in this gene cause Keutel syndrome in human patients, which is characterized by abnormal cartilage calcification, peripheral pulmonary stenosis and facial hypoplasia. [provided by RefSeq, Sep 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


