Human POMC/ACTH/CLIP ORF/cDNA clone-Lentivirus particle (NM_001035256)
Cat. No.: vGMLP004805
Pre-made Human POMC/ACTH/CLIP Lentiviral expression plasmid for POMC lentivirus packaging, POMC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
POMC/ACTH products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004805 | Human POMC Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004805 |
| Gene Name | POMC |
| Accession Number | NM_001035256 |
| Gene ID | 5443 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 804 bp |
| Gene Alias | ACTH,CLIP,LPH,MSH,NPP,POC |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCCGAGATCGTGCTGCAGCCGCTCGGGGGCCCTGTTGCTGGCCTTGCTGCTTCAGGCCTCCATGGAAGTGCGTGGCTGGTGCCTGGAGAGCAGCCAGTGTCAGGACCTCACCACGGAAAGCAACCTGCTGGAGTGCATCCGGGCCTGCAAGCCCGACCTCTCGGCCGAGACTCCCATGTTCCCGGGAAATGGCGACGAGCAGCCTCTGACCGAGAACCCCCGGAAGTACGTCATGGGCCACTTCCGCTGGGACCGATTCGGCCGCCGCAACAGCAGCAGCAGCGGCAGCAGCGGCGCAGGGCAGAAGCGCGAGGACGTCTCAGCGGGCGAAGACTGCGGCCCGCTGCCTGAGGGCGGCCCCGAGCCCCGCAGCGATGGTGCCAAGCCGGGCCCGCGCGAGGGCAAGCGCTCCTACTCCATGGAGCACTTCCGCTGGGGCAAGCCGGTGGGCAAGAAGCGGCGCCCAGTGAAGGTGTACCCTAACGGCGCCGAGGACGAGTCGGCCGAGGCCTTCCCCCTGGAGTTCAAGAGGGAGCTGACTGGCCAGCGACTCCGGGAGGGAGATGGCCCCGACGGCCCTGCCGATGACGGCGCAGGGGCCCAGGCCGACCTGGAGCACAGCCTGCTGGTGGCGGCCGAGAAGAAGGACGAGGGCCCCTACAGGATGGAGCACTTCCGCTGGGGCAGCCCGCCCAAGGACAAGCGCTACGGCGGTTTCATGACCTCCGAGAAGAGCCAGACGCCCCTGGTGACGCTGTTCAAAAACGCCATCATCAAGAACGCCTACAAGAAGGGCGAGTGA |
| ORF Protein Sequence | MPRSCCSRSGALLLALLLQASMEVRGWCLESSQCQDLTTESNLLECIRACKPDLSAETPMFPGNGDEQPLTENPRKYVMGHFRWDRFGRRNSSSSGSSGAGQKREDVSAGEDCGPLPEGGPEPRSDGAKPGPREGKRSYSMEHFRWGKPVGKKRRPVKVYPNGAEDESAEAFPLEFKRELTGQRLREGDGPDGPADDGAGAQADLEHSLLVAAEKKDEGPYRMEHFRWGSPPKDKRYGGFMTSEKSQTPLVTLFKNAIIKNAYKKGE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T62912-Ab | Anti-COLI/ POMC/ ACTH functional antibody |
| Target Antigen | GM-Tg-g-T62912-Ag | POMC protein |
| ORF Viral Vector | pGMLP004805 | Human POMC Lentivirus plasmid |
| ORF Viral Vector | vGMLP004805 | Human POMC Lentivirus particle |
Target information
| Target ID | GM-T62912 |
| Target Name | POMC |
| Gene ID | 5443, 18976, 694430, 24664, 101087223, 403659, 281416, 100071524 |
| Gene Symbol and Synonyms | ACTH,alpha-MSH,alphaMSH,BE,Beta-LPH,beta-MSH,CLIP,Gamma-LPH,gamma-MSH,LPH,MSH,NPP,OBAIRH,POC,POMC,Pomc-1,Pomc1,Pomc2 |
| Uniprot Accession | P01189 |
| Uniprot Entry Name | COLI_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Diagnostics Biomarker |
| Disease | Cancer |
| Gene Ensembl | ENSG00000115138 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a preproprotein that undergoes extensive, tissue-specific, post-translational processing via cleavage by subtilisin-like enzymes known as prohormone convertases. There are eight potential cleavage sites within the preproprotein and, depending on tissue type and the available convertases, processing may yield as many as ten biologically active peptides involved in diverse cellular functions. The encoded protein is synthesized mainly in corticotroph cells of the anterior pituitary where four cleavage sites are used; adrenocorticotrophin, essential for normal steroidogenesis and the maintenance of normal adrenal weight, and lipotropin beta are the major end products. In other tissues, including the hypothalamus, placenta, and epithelium, all cleavage sites may be used, giving rise to peptides with roles in pain and energy homeostasis, melanocyte stimulation, and immune modulation. These include several distinct melanotropins, lipotropins, and endorphins that are contained within the adrenocorticotrophin and beta-lipotropin peptides. The antimicrobial melanotropin alpha peptide exhibits antibacterial and antifungal activity. Mutations in this gene have been associated with early onset obesity, adrenal insufficiency, and red hair pigmentation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jan 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


