Human ZBED3 ORF/cDNA clone-Lentivirus particle (NM_001329564)

Cat. No.: vGMLP004823

Pre-made Human ZBED3/ Lentiviral expression plasmid for ZBED3 lentivirus packaging, ZBED3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ZBED3/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004823 Human ZBED3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004823
Gene Name ZBED3
Accession Number NM_001329564
Gene ID 84327
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 705 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGAGTGGCGAGCCGGCCTGCACCATGGACCAGGCCCGCGGGCTGGACGACGCGGCGGCGCGGGGCGGTCAGTGTCCGGGACTGGGGCCGGCGCCGACGCCGACGCCTCCCGGCCGCCTGGGGGCGCCATACTCCGAGGCCTGGGGCTACTTCCACCTGGCGCCGGGGCGCCCCGGGCATCCGTCGGGCCACTGGGCCACCTGCCGTCTGTGCGGGGAGCAGGTGGGCCGCGGCCCGGGCTTCCACGCGGGGACCTCGGCGTTGTGGAGGCACCTGAGGAGCGCGCACCGGCGGGAGCTGGAGAGCAGCGGCGCCGGGAGCTCCCCACCTGCCGCGCCCTGCCCGCCGCCGCCCGGCCCCGCTGCGGCCCCCGAGGGCGACTGGGCGCGCCTGCTGGAACAGATGGGCGCGCTGGCCGTGCGCGGCAGCCGGCGGGAGCGGGAGCTGGAGCGGCGCGAGCTGGCCGTGGAGCAGGGCGAGCGCGCCCTGGAGCGGAGGCGGAGGGCGCTGCAGGAGGAAGAGCGCGCCGCGGCCCAGGCGCGCCGGGAACTGCAGGCCGAGCGGGAGGCGCTGCAGGCGCGGCTGCGGGATGTGAGCCGCCGTGAGGGCGCCCTGGGCTGGGCCCCCGCTGCGCCGCCGCCGCTCAAGGACGACCCCGAGGGTGACAGGGACGGCTGCGTCATCACAAAGGTCCTCCTGTAG
ORF Protein Sequence MRSGEPACTMDQARGLDDAAARGGQCPGLGPAPTPTPPGRLGAPYSEAWGYFHLAPGRPGHPSGHWATCRLCGEQVGRGPGFHAGTSALWRHLRSAHRRELESSGAGSSPPAAPCPPPPGPAAAPEGDWARLLEQMGALAVRGSRRERELERRELAVEQGERALERRRRALQEEERAAAQARRELQAEREALQARLRDVSRREGALGWAPAAPPPLKDDPEGDRDGCVITKVLL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0612-Ab Anti-ZBED3 functional antibody
    Target Antigen GM-Tg-g-SE0612-Ag ZBED3 protein
    ORF Viral Vector pGMLP004823 Human ZBED3 Lentivirus plasmid
    ORF Viral Vector vGMLP004823 Human ZBED3 Lentivirus particle


    Target information

    Target ID GM-SE0612
    Target Name ZBED3
    Gene ID 84327, 72114, 707787, 361881, 102902086, 119871294, 615651, 102147885
    Gene Symbol and Synonyms 0610037K01Rik,2610005H11Rik,ZBED3
    Uniprot Accession Q96IU2
    Uniprot Entry Name ZBED3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000132846
    Target Classification Not Available

    This gene belongs to a class of genes that arose through hAT DNA transposition and that encode regulatory proteins. This gene is upregulated in lung cancer tissues, where the encoded protein causes an accumulation of beta-catenin and enhanced lung cancer cell invasion. In addition, the encoded protein can be secreted and be involved in resistance to insulin. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.