Human HDGF/HMG1L2 ORF/cDNA clone-Lentivirus particle (NM_001319186)
Cat. No.: vGMLP004865
Pre-made Human HDGF/HMG1L2 Lentiviral expression plasmid for HDGF lentivirus packaging, HDGF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
HDGF/HMG1L2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004865 | Human HDGF Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004865 |
| Gene Name | HDGF |
| Accession Number | NM_001319186 |
| Gene ID | 3068 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 792 bp |
| Gene Alias | HMG1L2 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCACCCGGAAGGTGGCCAATTTGTGCCTCAACTCCTTGGCCATCTCCTGGCTACCAAACTCAAGCGTTTCCTCCTTAGCAAAGGCGGACGTAGGGCTCAAATCCCCGACGTTTCCAGGGCCACCCCCCATACGATTGACGAGATGCCTGAGGCTGCCGTGAAATCAACAGCCAACAAATACCAAGTCTTTTTTTTCGGGACCCACGAGACGGCATTCCTGGGCCCCAAAGACCTCTTCCCTTACGAGGAATCCAAGGAGAAGTTTGGCAAGCCCAACAAGAGGAAAGGGTTCAGCGAGGGGCTGTGGGAGATCGAGAACAACCCTACTGTCAAGGCTTCCGGCTATCAGCCTGTGCTGTCTCTGCTGCAGTCCTCCCAGAAAAAGAGCTGTGTGGAAGAGCCTGAACCAGAGCCCGAAGCTGCAGAGGGTGACGGTGATAAGAAGGGGAATGCAGAGGGCAGCAGCGACGAGGAAGGGAAGCTGGTCATTGATGAGCCAGCCAAGGAGAAGAACGAGAAAGGAGCGTTGAAGAGGAGAGCAGGGGACTTGCTGGAGGACTCTCCTAAACGTCCCAAGGAGGCAGAAAACCCTGAAGGAGAGGAGAAGGAGGCAGCCACCTTGGAGGTTGAGAGGCCCCTTCCTATGGAGGTGGAAAAGAATAGCACCCCCTCTGAGCCCGGCTCTGGCCGGGGGCCTCCCCAAGAGGAAGAAGAGGAGGAGGATGAAGAGGAAGAGGCTACCAAGGAAGATGCTGAGGCCCCAGGCATCAGAGATCATGAGAGCCTGTAG |
| ORF Protein Sequence | MHPEGGQFVPQLLGHLLATKLKRFLLSKGGRRAQIPDVSRATPHTIDEMPEAAVKSTANKYQVFFFGTHETAFLGPKDLFPYEESKEKFGKPNKRKGFSEGLWEIENNPTVKASGYQPVLSLLQSSQKKSCVEEPEPEPEAAEGDGDKKGNAEGSSDEEGKLVIDEPAKEKNEKGALKRRAGDLLEDSPKRPKEAENPEGEEKEAATLEVERPLPMEVEKNSTPSEPGSGRGPPQEEEEEEDEEEEATKEDAEAPGIRDHESL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T84341-Ab | Anti-HDGF/ HMG1L2 functional antibody |
| Target Antigen | GM-Tg-g-T84341-Ag | HDGF protein |
| ORF Viral Vector | pGMLP004865 | Human HDGF Lentivirus plasmid |
| ORF Viral Vector | vGMLP004865 | Human HDGF Lentivirus particle |
Target information
| Target ID | GM-T84341 |
| Target Name | HDGF |
| Gene ID | 3068, 15191, 716742, 114499, 101082623, 100856751, 327953, 100064506 |
| Gene Symbol and Synonyms | D3Ertd299e,HDGF,HMG1L2 |
| Uniprot Accession | P51858 |
| Uniprot Entry Name | HDGF_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000143321 |
| Target Classification | Not Available |
This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


