Human CNPY3/CAG4A/ EIEE60 ORF/cDNA clone-Lentivirus particle (NM_001318842)

Pre-made Human CNPY3/CAG4A/ EIEE60 Lentiviral expression plasmid for CNPY3 lentivirus packaging, CNPY3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CNPY3/CAG4A products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004908 Human CNPY3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004908
Gene Name CNPY3
Accession Number NM_001318842
Gene ID 10695
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 936 bp
Gene Alias CAG4A, EIEE60, ERDA5, PRAT4A, TNRC5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGATTCAATGCCTGAGCCCGCGTCCCGCTGTCTTCTGCTTCTTCCCTTGCTGCTGCTGCTGCTGCTGCTGCTGCCGGCCCCGGAGCTGGGCCCGAGCCAGGCCGGAGCTGAGGAGAACGACTGGGTTCGCCTGCCCAGCAAATGCGAAGTGTGTAAATATGTTGCTGTGGAGCTGAAGTCAGCCTTTGAGGAAACCGGCAAGACCAAGGAGGTGATTGGCACGGGCTATGGCATCCTGGACCAGAAGGCCTCTGGAGTCAAATACACCAAGTCCATTTCAGATCCCCCAGACCAGATGACCTATCTTCCTTCCAGCTCTGAGTCACTTCCCATTGGAGGGGAACTCAGTTCCTCATCCTCCTGTCTTGGCAGGGACTTGCGGTTAATCGAAGTCACTGAGACCATTTGCAAGAGGCTCCTGGATTATAGCCTGCACAAGGAGAGGACCGGCAGCAATCGATTTGCCAAGGGCATGTCAGAGACCTTTGAGACATTACACAACCTGGTACACAAAGGGGTCAAGGTGGTGATGGACATCCCCTATGAGCTGTGGAACGAGACTTCTGCAGAGGTGGCTGACCTCAAGAAGCAGTGTGATGTGCTGGTGGAAGAGTTTGAGGAGGTGATCGAGGACTGGTACAGGAACCACCAGGAGGAAGACCTGACTGAATTCCTCTGCGCCAACCACGTGCTGAAGGGAAAAGACACCAGTTGCCTGGCAGAGCAGTGGTCCGGCAAGAAGGGAGACACAGCTGCCCTGGGAGGGAAGAAGTCCAAGAAGAAGAGCAGCAGGGCCAAGGCAGCAGGCGGCAGGAGTAGCAGCAGCAAACAAAGGAAGGAGCTGGGTGGCCTTGAGGGAGACCCCAGCCCCGAGGAGGATGAGGGCATCCAGAAGGCATCCCCTCTCACACACAGCCCCCCTGATGAGCTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1507-Ab Anti-CNPY3/ CAG4A/ EIEE60 functional antibody
    Target Antigen GM-Tg-g-SE1507-Ag CNPY3 protein
    ORF Viral Vector pGMLP004908 Human CNPY3 Lentivirus plasmid
    ORF Viral Vector vGMLP004908 Human CNPY3 Lentivirus particle
    ORF Viral Vector pGMLV002449 Human CNPY3 Lentivirus plasmid


    Target information

    Target ID GM-SE1507
    Target Name CNPY3
    Gene ID 10695, 72029, 100424676, 685174, 101082750, 609385, 510220, 100067096
    Gene Symbol and Synonyms 1600025D17Rik,2410050O22Rik,CAG4A,CNPY3,DEE60,EIEE60,ERDA5,PRAT4A,TNRC5
    Uniprot Accession Q9BT09
    Uniprot Entry Name CNPY3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000137161
    Target Classification Not Available

    This gene encodes a protein that binds members of the toll-like receptor protein family and functions as a chaperone to aid in folding and export of these proteins. Alternative splicing results in multiple transcript variants. Naturally occuring readthrough transcription occurs between this locus and the downstream GNMT (glycine N-methyltransferase) gene and is represented with GeneID:107080644. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.