Human HCCS/CCHL/ LSDMCA1 ORF/cDNA clone-Lentivirus particle (NM_005333)
Pre-made Human HCCS/CCHL/ LSDMCA1 Lentiviral expression plasmid for HCCS lentivirus packaging, HCCS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to HCCS/CCHL products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004992 | Human HCCS Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004992 |
Gene Name | HCCS |
Accession Number | NM_005333 |
Gene ID | 3052 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 807 bp |
Gene Alias | CCHL, LSDMCA1, MCOPS7, MLS |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGTTTGTCTCCATCTGCTCCTGCTGTTGCAGTTCAGGCCTCAAATGCTTCAGCGTCCCCACCTTCAGGATGCCCGATGCATGAAGGGAAAATGAAAGGCTGTCCAGTGAATACAGAGCCATCTGGCCCAACCTGTGAGAAGAAAACATACTCTGTGCCTGCCCACCAGGAACGCGCCTATGAGTACGTGGAGTGTCCCATTAGGGGCACTGCGGCTGAGAATAAGGAGAACCTAGATCCTTCAAATCTGATGCCACCACCAAATCAAACACCAGCTCCAGATCAGCCATTTGCATTGTCTACTGTCAGAGAAGAGTCATCCATTCCGAGAGCAGATTCAGAGAAAAAGTGGGTTTACCCTTCTGAGCAGATGTTCTGGAATGCAATGTTAAAGAAAGGGTGGAAGTGGAAGGATGAGGATATCAGTCAGAAGGATATGTATAATATCATTAGAATTCACAATCAGAATAACGAGCAGGCTTGGAAGGAGATTTTGAAGTGGGAAGCCCTTCATGCTGCAGAGTGTCCTTGTGGTCCATCATTGATCCGGTTTGGAGGGAAAGCAAAAGAGTATTCACCAAGGGCACGAATTCGTTCCTGGATGGGGTATGAGTTGCCTTTTGATAGGCACGATTGGATCATAAACCGTTGCGGGACAGAAGTTAGATATGTGATTGATTATTATGATGGTGGTGAAGTCAACAAGGACTACCAGTTCACCATCCTGGACGTCCGTCCTGCCTTAGATTCACTTTCGGCAGTATGGGACAGAATGAAAGTCGCTTGGTGGCGTTGGACCTCGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1398-Ab | Anti-CCHL/ HCCS/ LSDMCA1 functional antibody |
Target Antigen | GM-Tg-g-SE1398-Ag | HCCS protein |
ORF Viral Vector | pGMLP004992 | Human HCCS Lentivirus plasmid |
ORF Viral Vector | vGMLP004992 | Human HCCS Lentivirus particle |
Target information
Target ID | GM-SE1398 |
Target Name | HCCS |
Gene ID | 3052, 15159, 709878, 317444, 101085440, 480834, 506250, 100053680 |
Gene Symbol and Synonyms | CCHL,HCCS,LSDMCA1,MCOPS7,MLS,RGD1563855 |
Uniprot Accession | P53701 |
Uniprot Entry Name | CCHL_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000004961 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is an enzyme that covalently links a heme group to the apoprotein of cytochrome c. Defects in this gene are a cause of microphthalmia syndromic type 7 (MCOPS7). Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.