Human HCCS/CCHL/ LSDMCA1 ORF/cDNA clone-Lentivirus particle (NM_005333)

Pre-made Human HCCS/CCHL/ LSDMCA1 Lentiviral expression plasmid for HCCS lentivirus packaging, HCCS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to HCCS/CCHL products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004992 Human HCCS Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004992
Gene Name HCCS
Accession Number NM_005333
Gene ID 3052
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 807 bp
Gene Alias CCHL, LSDMCA1, MCOPS7, MLS
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGTTTGTCTCCATCTGCTCCTGCTGTTGCAGTTCAGGCCTCAAATGCTTCAGCGTCCCCACCTTCAGGATGCCCGATGCATGAAGGGAAAATGAAAGGCTGTCCAGTGAATACAGAGCCATCTGGCCCAACCTGTGAGAAGAAAACATACTCTGTGCCTGCCCACCAGGAACGCGCCTATGAGTACGTGGAGTGTCCCATTAGGGGCACTGCGGCTGAGAATAAGGAGAACCTAGATCCTTCAAATCTGATGCCACCACCAAATCAAACACCAGCTCCAGATCAGCCATTTGCATTGTCTACTGTCAGAGAAGAGTCATCCATTCCGAGAGCAGATTCAGAGAAAAAGTGGGTTTACCCTTCTGAGCAGATGTTCTGGAATGCAATGTTAAAGAAAGGGTGGAAGTGGAAGGATGAGGATATCAGTCAGAAGGATATGTATAATATCATTAGAATTCACAATCAGAATAACGAGCAGGCTTGGAAGGAGATTTTGAAGTGGGAAGCCCTTCATGCTGCAGAGTGTCCTTGTGGTCCATCATTGATCCGGTTTGGAGGGAAAGCAAAAGAGTATTCACCAAGGGCACGAATTCGTTCCTGGATGGGGTATGAGTTGCCTTTTGATAGGCACGATTGGATCATAAACCGTTGCGGGACAGAAGTTAGATATGTGATTGATTATTATGATGGTGGTGAAGTCAACAAGGACTACCAGTTCACCATCCTGGACGTCCGTCCTGCCTTAGATTCACTTTCGGCAGTATGGGACAGAATGAAAGTCGCTTGGTGGCGTTGGACCTCGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1398-Ab Anti-CCHL/ HCCS/ LSDMCA1 functional antibody
    Target Antigen GM-Tg-g-SE1398-Ag HCCS protein
    ORF Viral Vector pGMLP004992 Human HCCS Lentivirus plasmid
    ORF Viral Vector vGMLP004992 Human HCCS Lentivirus particle


    Target information

    Target ID GM-SE1398
    Target Name HCCS
    Gene ID 3052, 15159, 709878, 317444, 101085440, 480834, 506250, 100053680
    Gene Symbol and Synonyms CCHL,HCCS,LSDMCA1,MCOPS7,MLS,RGD1563855
    Uniprot Accession P53701
    Uniprot Entry Name CCHL_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000004961
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is an enzyme that covalently links a heme group to the apoprotein of cytochrome c. Defects in this gene are a cause of microphthalmia syndromic type 7 (MCOPS7). Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.