Human LZTFL1/BBS17 ORF/cDNA clone-Lentivirus particle (NM_020347)

Cat. No.: vGMLP004994

Pre-made Human LZTFL1/BBS17 Lentiviral expression plasmid for LZTFL1 lentivirus packaging, LZTFL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to LZTFL1/BBS17 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004994 Human LZTFL1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004994
Gene Name LZTFL1
Accession Number NM_020347
Gene ID 54585
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 900 bp
Gene Alias BBS17
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGAGTTGGGCCTAAATGAGCACCATCAAAATGAAGTTATTAATTATATGCGTTTTGCTCGTTCAAAGAGAGGCTTGAGACTCAAAACTGTAGATTCCTGCTTCCAAGACCTCAAGGAGAGCAGGCTGGTGGAGGACACCTTCACCATAGATGAAGTCTCTGAAGTCCTCAATGGATTACAAGCTGTGGTTCATAGTGAGGTGGAATCTGAGCTCATCAACACTGCCTATACCAATGTGTTACTTCTGCGACAGCTGTTTGCACAAGCTGAGAAGTGGTATCTTAAGCTACAGACAGACATCTCTGAACTTGAAAACCGAGAATTATTAGAACAAGTTGCAGAATTTGAAAAAGCAGAGATTACATCTTCAAACAAAAAGCCCATCTTAGATGTCACAAAGCCAAAACTTGCTCCACTTAATGAAGGTGGAACAGCAGAACTCCTAAACAAGGAAATTTTAAGACTTCAAGAAGAGAATGAGAAATTGAAGTCAAGGTTGAAGACCATTGAAATACAGGCTACAAATGCACTGGATGAAAAGTCAAAACTAGAAAAAGCACTGCAAGATTTACAGCTTGATCAAGGAAATCAAAAGGATTTTATAAAGGCCCAAGACTTAAGTAACTTAGAAAACACTGTCGCTGCCTTAAAGAGTGAGTTTCAGAAGACACTTAATGACAAGACAGAAAACCAGAAGTCACTGGAGGAGAATCTGGCGACAGCCAAGCACGATCTACTCAGGGTTCAGGAGCAGCTGCACATGGCTGAAAAGGAATTAGAAAAGAAATTTCAGCAAACAGCAGCTTATCGAAACATGAAAGAGATTCTTACCAAGAAGAATGACCAAATCAAAGATCTGAGGAAAAGACTGGCACAATATGAACCTGAAGATTAA
ORF Protein Sequence MAELGLNEHHQNEVINYMRFARSKRGLRLKTVDSCFQDLKESRLVEDTFTIDEVSEVLNGLQAVVHSEVESELINTAYTNVLLLRQLFAQAEKWYLKLQTDISELENRELLEQVAEFEKAEITSSNKKPILDVTKPKLAPLNEGGTAELLNKEILRLQEENEKLKSRLKTIEIQATNALDEKSKLEKALQDLQLDQGNQKDFIKAQDLSNLENTVAALKSEFQKTLNDKTENQKSLEENLATAKHDLLRVQEQLHMAEKELEKKFQQTAAYRNMKEILTKKNDQIKDLRKRLAQYEPED

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1132-Ab Anti-LZTFL1 monoclonal antibody
    Target Antigen GM-Tg-g-IP1132-Ag LZTFL1 protein
    ORF Viral Vector pGMLP004994 Human LZTFL1 Lentivirus plasmid
    ORF Viral Vector vGMLP004994 Human LZTFL1 Lentivirus particle


    Target information

    Target ID GM-IP1132
    Target Name LZTFL1
    Gene ID 54585, 93730, 714191, 316102, 101082984, 476651, 512570, 100054515
    Gene Symbol and Synonyms 5530402H04Rik,6130400H19Rik,BBS17,LZTFL1
    Uniprot Accession Q9NQ48
    Uniprot Entry Name LZTL1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000163818
    Target Classification Not Available

    This gene encodes a ubiquitously expressed protein that localizes to the cytoplasm. This protein interacts with Bardet-Biedl Syndrome (BBS) proteins and, through its interaction with BBS protein complexes, regulates protein trafficking to the ciliary membrane. Nonsense mutations in this gene cause a form of Bardet-Biedl Syndrome; a ciliopathy characterized in part by polydactyly, obesity, cognitive impairment, hypogonadism, and kidney failure. This gene may also function as a tumor suppressor; possibly by interacting with E-cadherin and the actin cytoskeleton and thereby regulating the transition of epithelial cells to mesenchymal cells. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.