Human MSRB2/CBS-1/ CBS1 ORF/cDNA clone-Lentivirus particle (NM_012228)

Pre-made Human MSRB2/CBS-1/ CBS1 Lentiviral expression plasmid for MSRB2 lentivirus packaging, MSRB2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to MSRB2/CBS-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005012 Human MSRB2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005012
Gene Name MSRB2
Accession Number NM_012228
Gene ID 22921
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 549 bp
Gene Alias CBS-1, CBS1, CGI-131, MSRB, PILB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGCGGCTCCTCTGGTTGCTCCGGGGCCTGACCCTCGGAACTGCGCCTCGGCGGGCGGTGCGGGGCCAAGCGGGCGGCGGCGGGCCCGGCACCGGGCCGGGACTGGGGGAGGCAGGGTCTCTTGCAACGTGTGAGCTGCCTCTTGCCAAGAGTGAGTGGCAAAAGAAACTAACCCCGGAGCAGTTCTACGTCACAAGAGAAAAGGGAACGGAACCGCCTTTCAGTGGGATCTACCTGAATAACAAGGAAGCAGGAATGTATCATTGCGTGTGCTGCGACAGTCCACTCTTCAGTTCTGAGAAAAAGTACTGCTCTGGCACTGGGTGGCCTTCGTTTTCCGAGGCTCATGGTACGTCTGGCTCTGATGAAAGCCACACAGGGATCCTGAGACGTCTGGATACCTCGTTAGGATCAGCTCGCACAGAGGTTGTCTGCAAGCAGTGTGAAGCTCATCTAGGTCACGTGTTTCCTGATGGACCTGGGCCCAATGGTCAGAGGTTTTGCATCAACAGTGTGGCTTTGAAGTTCAAACCAAGGAAACACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1536-Ab Anti-MSRB2/ CBS-1/ CBS1 functional antibody
    Target Antigen GM-Tg-g-SE1536-Ag MSRB2 protein
    ORF Viral Vector pGMLP005012 Human MSRB2 Lentivirus plasmid
    ORF Viral Vector vGMLP005012 Human MSRB2 Lentivirus particle


    Target information

    Target ID GM-SE1536
    Target Name MSRB2
    Gene ID 22921, 76467, 711305, 361286, 123386852, 608357, 613475, 100055714
    Gene Symbol and Synonyms 2310050L06Rik,CBS-1,CBS1,CGI-131,Mrsb,MSRB,MSRB2,PILB
    Uniprot Accession Q9Y3D2
    Uniprot Entry Name MSRB2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000148450
    Target Classification Not Available

    Predicted to enable actin binding activity; peptide-methionine (R)-S-oxide reductase activity; and zinc ion binding activity. Predicted to be involved in actin filament polymerization and protein repair. Predicted to be located in mitochondrion. Predicted to be active in cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.