Human METRNL ORF/cDNA clone-Lentivirus particle (NM_001004431)

Pre-made Human METRNL/ Lentiviral expression plasmid for METRNL lentivirus packaging, METRNL lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to METRNL/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005024 Human METRNL Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005024
Gene Name METRNL
Accession Number NM_001004431
Gene ID 284207
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 936 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGGGGCGCGGCGCGGGCGGCCTGGGGGCGCGCGGGGCAGCCGTGGCCGCGACCCCCCGCCCCGGGCCCGCCCCCGCCGCCGCTCCCGCTGCTGCTCCTGCTCCTGGCCGGGCTGCTGGGCGGCGCGGGCGCGCAGTACTCCAGCGACCGGTGCAGCTGGAAGGGGAGCGGGCTGACGCACGAGGCACACAGGAAGGAGGTGGAGCAGGTGTATCTGCGCTGTGCGGCGGGTGCCGTGGAGTGGATGTACCCAACAGGTGCTCTCATCGTTAACCTGCGGCCCAACACCTTCTCGCCTGCCCGGCACCTGACCGTGTGCATCAGGTCCTTCACGGACTCCTCGGGGGCCAATATTTATTTGGAAAAAACTGGAGAACTGAGACTGCTGGTACCAGACGGGGACGGCAGGCCCGGCCGGGTGCAGTGTTTTGGCCTGGAGCAGGGCGGCCTGTTCGTGGAGGCCACGCCGCAGCAGGATATCGGCCGGAGGACCACAGGCTTCCAGTACGAGCTGGTTAGGAGGCACAGGGCGTCGGACCTGCACGAGCTGTCTGCGCCGTGCCGTCCCTGCAGTGACACCGAGGTGCTCCTAGCCGTCTGCACCAGCGACTTCGCCGTTCGAGGCTCCATCCAGCAAGTTACCCACGAGCCTGAGCGGCAGGACTCAGCCATCCACCTGCGCGTGAGCAGACTCTATCGGCAGAAAAGCAGGGTCTTCGAGCCGGTGCCCGAGGGTGACGGCCACTGGCAGGGGCGCGTCAGGACGCTGCTGGAGTGTGGCGTGCGGCCGGGGCATGGCGACTTCCTCTTCACTGGCCACATGCACTTCGGGGAGGCGCGGCTCGGCTGTGCCCCACGCTTCAAGGACTTCCAGAGGATGTACAGGGATGCCCAGGAGAGGGGGCTGAACCCTTGTGAGGTTGGCACGGACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1096-Ab Anti-METRL/ METRNL functional antibody
    Target Antigen GM-Tg-g-SE1096-Ag METRNL protein
    ORF Viral Vector pGMAAV000374 Human METRNL Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP005024 Human METRNL Lentivirus plasmid
    ORF Viral Vector vGMAAV000374 Human METRNL Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP005024 Human METRNL Lentivirus particle


    Target information

    Target ID GM-SE1096
    Target Name METRNL
    Gene ID 284207, 210029, 719751, 316842, 101084587, 608424, 534297, 100056359
    Gene Symbol and Synonyms 9430048M07Rik,METRNL
    Uniprot Accession Q641Q3
    Uniprot Entry Name METRL_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000176845
    Target Classification Not Available

    Predicted to enable hormone activity. Predicted to be involved in several processes, including brown fat cell differentiation; energy homeostasis; and positive regulation of brown fat cell differentiation. Located in extracellular exosome. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.