Human VSTM1/SIRL-1/SIRL1 ORF/cDNA clone-Lentivirus particle (NM_198481)

Cat. No.: vGMLP005052

Pre-made Human VSTM1/SIRL-1/SIRL1 Lentiviral expression plasmid for VSTM1 lentivirus packaging, VSTM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to VSTM1/SIRL-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005052 Human VSTM1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005052
Gene Name VSTM1
Accession Number NM_198481
Gene ID 284415
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 711 bp
Gene Alias SIRL-1,SIRL1,UNQ3033
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCGCAGAATTCCTCTCCCTGCTTTGCCTCGGGCTGTGTCTGGGCTACGAAGATGAGAAAAAGAATGAGAAACCGCCCAAGCCCTCCCTCCACGCCTGGCCCAGCTCGGTGGTTGAAGCCGAGAGCAATGTGACCCTGAAGTGTCAGGCTCATTCCCAGAATGTGACATTTGTGCTGCGCAAGGTGAACGACTCTGGGTACAAGCAGGAACAGAGCTCGGCAGAAAACGAAGCTGAATTCCCCTTCACGGACCTGAAGCCTAAGGATGCTGGGAGGTACTTTTGTGCCTACAAGACAACAGCCTCCCATGAGTGGTCAGAAAGCAGTGAACACTTGCAGCTGGTGGTCACAGATAAACACGATGAACTTGAAGCTCCCTCAATGAAAACAGACACCAGAACCATCTTTGTCGCCATCTTCAGCTGCATCTCCATCCTTCTCCTCTTCCTCTCAGTCTTCATCATCTACAGATGCAGCCAGCACAGTTCATCATCTGAGGAATCCACCAAGAGAACCAGCCATTCCAAACTTCCGGAGCAGGAGGCTGCCGAGGCAGATTTATCCAATATGGAAAGGGTATCTCTCTCGACGGCAGACCCCCAAGGAGTGACCTATGCTGAGCTAAGCACCAGCGCCCTGTCTGAGGCAGCTTCAGACACCACCCAGGAGCCCCCAGGATCTCATGAATATGCGGCACTGAAAGTGTAG
ORF Protein Sequence MTAEFLSLLCLGLCLGYEDEKKNEKPPKPSLHAWPSSVVEAESNVTLKCQAHSQNVTFVLRKVNDSGYKQEQSSAENEAEFPFTDLKPKDAGRYFCAYKTTASHEWSESSEHLQLVVTDKHDELEAPSMKTDTRTIFVAIFSCISILLLFLSVFIIYRCSQHSSSSEESTKRTSHSKLPEQEAAEADLSNMERVSLSTADPQGVTYAELSTSALSEAASDTTQEPPGSHEYAALKV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0545-Ab Anti-VSTM1/ SIRL-1/ SIRL1 functional antibody
    Target Antigen GM-Tg-g-SE0545-Ag VSTM1 protein
    ORF Viral Vector pGMLP005052 Human VSTM1 Lentivirus plasmid
    ORF Viral Vector vGMLP005052 Human VSTM1 Lentivirus particle


    Target information

    Target ID GM-SE0545
    Target Name VSTM1
    Gene ID 284415, 722757, 100360054
    Gene Symbol and Synonyms SIRL-1,SIRL1,UNQ3033,VSTM1
    Uniprot Accession Q6UX27
    Uniprot Entry Name VSTM1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000189068
    Target Classification Not Available

    Predicted to enable cytokine activity. Predicted to be involved in immune system process and signal transduction. Predicted to be located in extracellular space. Predicted to be integral component of membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.