Human AMTN/AI3B/UNQ689 ORF/cDNA clone-Lentivirus particle (NM_212557)

Cat. No.: vGMLP005065

Pre-made Human AMTN/AI3B/UNQ689 Lentiviral expression plasmid for AMTN lentivirus packaging, AMTN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AMTN/AI3B products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005065 Human AMTN Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005065
Gene Name AMTN
Accession Number NM_212557
Gene ID 401138
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 630 bp
Gene Alias AI3B,UNQ689
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGAGTACGATTCTACTGTTTTGTCTTCTAGGATCAACTCGGTCATTACCACAGCTCAAACCTGCTTTGGGACTCCCTCCCACAAAACTGGCTCCGGATCAGGGAACACTACCAAACCAACAGCAGTCAAATCAGGTCTTTCCTTCTTTAAGTCTGATACCATTAACACAGATGCTCACACTGGGGCCAGATCTGCATCTGTTAAATCCTGCTGCAGGAATGACACCTGGTACCCAGACCCACCCATTGACCCTGGGAGGGTTGAATGTACAACAGCAACTGCACCCACATGTGTTACCAATTTTTGTCACACAACTTGGAGCCCAGGGCACTATCCTAAGCTCAGAGGAATTGCCACAAATCTTCACGAGCCTCATCATCCATTCCTTGTTCCCGGGAGGCATCCTGCCCACCAGTCAGGCAGGGGCTAATCCAGATGTCCAGGATGGAAGCCTTCCAGCAGGAGGAGCAGGTGTAAATCCTGCCACCCAGGGAACCCCAGCAGGCCGCCTCCCAACTCCCAGTGGCACAGATGACGACTTTGCAGTGACCACCCCTGCAGGCATCCAAAGGAGCACACATGCCATCGAGGAAGCCACCACAGAATCAGCAAATGGAATTCAGTAA
ORF Protein Sequence MRSTILLFCLLGSTRSLPQLKPALGLPPTKLAPDQGTLPNQQQSNQVFPSLSLIPLTQMLTLGPDLHLLNPAAGMTPGTQTHPLTLGGLNVQQQLHPHVLPIFVTQLGAQGTILSSEELPQIFTSLIIHSLFPGGILPTSQAGANPDVQDGSLPAGGAGVNPATQGTPAGRLPTPSGTDDDFAVTTPAGIQRSTHAIEEATTESANGIQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0661-Ab Anti-AMTN/ AI3B/ UNQ689 functional antibody
    Target Antigen GM-Tg-g-SE0661-Ag AMTN protein
    ORF Viral Vector pGMLP005065 Human AMTN Lentivirus plasmid
    ORF Viral Vector vGMLP005065 Human AMTN Lentivirus particle


    Target information

    Target ID GM-SE0661
    Target Name AMTN
    Gene ID 401138, 71421, 707054, 689404, 101097314, 611794, 618393, 100054100
    Gene Symbol and Synonyms 5430427O21Rik,AI3B,AMTN,UNQ689
    Uniprot Accession Q6UX39
    Uniprot Entry Name AMTN_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000187689
    Target Classification Not Available

    The mineralized portions of teeth, the dentin and enamel, are formed by mesenchyme-derived odontoblasts and epithelium-derived ameloblasts, respectively. As ameloblasts differentiate, they deposit specific proteins necessary for enamel formation, including amelogenin (AMELX; MIM 300391), enamelin (ENAM; MIM 606585), and ameloblastin (AMBN; MIM 601259), in the organic enamel matrix. Amelotin is specifically expressed in maturation-stage ameloblasts (Iwasaki et al., 2005 [PubMed 16304441]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.