Human CCDC115/ccp1/CDG2O ORF/cDNA clone-Lentivirus particle (NM_032357)
Cat. No.: vGMLP005080
Pre-made Human CCDC115/ccp1/CDG2O Lentiviral expression plasmid for CCDC115 lentivirus packaging, CCDC115 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CCDC115/ccp1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP005080 | Human CCDC115 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP005080 |
Gene Name | CCDC115 |
Accession Number | NM_032357 |
Gene ID | 84317 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 543 bp |
Gene Alias | ccp1,CDG2O |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGGCGCTTGACCTGCGAGCGGAGCTGGATTCGCTGGTCCTGCAGCTGCTTGGGGACCTGGAGGAGCTGGAGGGGAAACGAACGGTGTTGAACGCCCGGGTGGAGGAGGGCTGGCTCTCGCTCGCCAAGGCTCGCTACGCGATGGGCGCCAAGTCGGTAGGGCCCCTGCAGTATGCTTCCCACATGGAGCCCCAGGTCTGCCTCCACGCCAGCGAGGCCCAGGAGGGACTCCAGAAGTTCAAGGTGGTGAGAGCTGGTGTCCACGCCCCAGAGGAGGTGGGGCCTCGCGAAGCAGGTCTGCGGAGGCGCAAGGGCCCCACTAAGACCCCAGAACCGGAGTCCTCTGAGGCCCCTCAGGACCCCCTGAACTGGTTTGGAATCCTAGTTCCTCACAGTCTACGTCAGGCTCAAGCAAGCTTCCGGGATGGCCTGCAGCTGGCCGCAGACATAGCCAGCCTCCAGAACCGCATTGACTGGGGTCGAAGCCAGCTCCGGGGACTCCAAGAGAAACTCAAGCAGCTGGAGCCTGGGGCTGCCTGA |
ORF Protein Sequence | MAALDLRAELDSLVLQLLGDLEELEGKRTVLNARVEEGWLSLAKARYAMGAKSVGPLQYASHMEPQVCLHASEAQEGLQKFKVVRAGVHAPEEVGPREAGLRRRKGPTKTPEPESSEAPQDPLNWFGILVPHSLRQAQASFRDGLQLAADIASLQNRIDWGRSQLRGLQEKLKQLEPGAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP2404-Ab | Anti-CCDC115 monoclonal antibody |
Target Antigen | GM-Tg-g-IP2404-Ag | CCDC115 protein |
ORF Viral Vector | pGMLP005080 | Human CCDC115 Lentivirus plasmid |
ORF Viral Vector | vGMLP005080 | Human CCDC115 Lentivirus particle |
Target information
Target ID | GM-IP2404 |
Target Name | CCDC115 |
Gene ID | 84317, 69668, 702032, 363213, 101080349, 606806, 513406, 106781893 |
Gene Symbol and Synonyms | 2310061I09Rik,CCDC115,ccp1,CDG2O,RGD1304653 |
Uniprot Accession | Q96NT0 |
Uniprot Entry Name | CC115_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000136710 |
Target Classification | Not Available |
The protein encoded by this gene has been observed to localize to the endoplasmic reticulum (ER)-Golgi intermediate compartment (ERGIC) and coat protein complex I (COPI) vesicles in some human cells. The encoded protein shares some homology with the yeast V-ATPase assembly factor Vma22p, and the orthologous protein in mouse promotes cell proliferation and suppresses cell death. Defects in this gene are a cause of congenital disorder of glycosylation, type IIo in humans. [provided by RefSeq, Mar 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.