Human CCDC115/ccp1/CDG2O ORF/cDNA clone-Lentivirus particle (NM_032357)

Cat. No.: vGMLP005080

Pre-made Human CCDC115/ccp1/CDG2O Lentiviral expression plasmid for CCDC115 lentivirus packaging, CCDC115 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CCDC115/ccp1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005080 Human CCDC115 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005080
Gene Name CCDC115
Accession Number NM_032357
Gene ID 84317
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 543 bp
Gene Alias ccp1,CDG2O
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCGCTTGACCTGCGAGCGGAGCTGGATTCGCTGGTCCTGCAGCTGCTTGGGGACCTGGAGGAGCTGGAGGGGAAACGAACGGTGTTGAACGCCCGGGTGGAGGAGGGCTGGCTCTCGCTCGCCAAGGCTCGCTACGCGATGGGCGCCAAGTCGGTAGGGCCCCTGCAGTATGCTTCCCACATGGAGCCCCAGGTCTGCCTCCACGCCAGCGAGGCCCAGGAGGGACTCCAGAAGTTCAAGGTGGTGAGAGCTGGTGTCCACGCCCCAGAGGAGGTGGGGCCTCGCGAAGCAGGTCTGCGGAGGCGCAAGGGCCCCACTAAGACCCCAGAACCGGAGTCCTCTGAGGCCCCTCAGGACCCCCTGAACTGGTTTGGAATCCTAGTTCCTCACAGTCTACGTCAGGCTCAAGCAAGCTTCCGGGATGGCCTGCAGCTGGCCGCAGACATAGCCAGCCTCCAGAACCGCATTGACTGGGGTCGAAGCCAGCTCCGGGGACTCCAAGAGAAACTCAAGCAGCTGGAGCCTGGGGCTGCCTGA
ORF Protein Sequence MAALDLRAELDSLVLQLLGDLEELEGKRTVLNARVEEGWLSLAKARYAMGAKSVGPLQYASHMEPQVCLHASEAQEGLQKFKVVRAGVHAPEEVGPREAGLRRRKGPTKTPEPESSEAPQDPLNWFGILVPHSLRQAQASFRDGLQLAADIASLQNRIDWGRSQLRGLQEKLKQLEPGAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2404-Ab Anti-CCDC115 monoclonal antibody
    Target Antigen GM-Tg-g-IP2404-Ag CCDC115 protein
    ORF Viral Vector pGMLP005080 Human CCDC115 Lentivirus plasmid
    ORF Viral Vector vGMLP005080 Human CCDC115 Lentivirus particle


    Target information

    Target ID GM-IP2404
    Target Name CCDC115
    Gene ID 84317, 69668, 702032, 363213, 101080349, 606806, 513406, 106781893
    Gene Symbol and Synonyms 2310061I09Rik,CCDC115,ccp1,CDG2O,RGD1304653
    Uniprot Accession Q96NT0
    Uniprot Entry Name CC115_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000136710
    Target Classification Not Available

    The protein encoded by this gene has been observed to localize to the endoplasmic reticulum (ER)-Golgi intermediate compartment (ERGIC) and coat protein complex I (COPI) vesicles in some human cells. The encoded protein shares some homology with the yeast V-ATPase assembly factor Vma22p, and the orthologous protein in mouse promotes cell proliferation and suppresses cell death. Defects in this gene are a cause of congenital disorder of glycosylation, type IIo in humans. [provided by RefSeq, Mar 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.