Human PIM2 ORF/cDNA clone-Lentivirus particle (NM_006875.3)

Cat. No.: vGMLP005248

Pre-made Human PIM2/ Lentiviral expression plasmid for PIM2 lentivirus packaging, PIM2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PIM2/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005248 Human PIM2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005248
Gene Name PIM2
Accession Number NM_006875.3
Gene ID 11040
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 936 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTGACCAAGCCTCTACAGGGGCCTCCCGCGCCCCCCGGGACCCCCACGCCGCCGCCAGGAGGCAAGGATCGGGAAGCGTTCGAGGCCGAGTATCGACTCGGCCCCCTCCTGGGTAAGGGGGGCTTTGGCACCGTCTTCGCAGGACACCGCCTCACAGATCGACTCCAGGTGGCCATCAAAGTGATTCCCCGGAATCGTGTGCTGGGCTGGTCCCCCTTGTCAGACTCAGTCACATGCCCACTCGAAGTCGCACTGCTATGGAAAGTGGGTGCAGGTGGTGGGCACCCTGGCGTGATCCGCCTGCTTGACTGGTTTGAGACACAGGAGGGCTTCATGCTGGTCCTCGAGCGGCCTTTGCCCGCCCAGGATCTCTTTGACTATATCACAGAGAAGGGCCCACTGGGTGAAGGCCCAAGCCGCTGCTTCTTTGGCCAAGTAGTGGCAGCCATCCAGCACTGCCATTCCCGTGGAGTTGTCCATCGTGACATCAAGGATGAGAACATCCTGATAGACCTACGCCGTGGCTGTGCCAAACTCATTGATTTTGGTTCTGGTGCCCTGCTTCATGATGAACCCTACACTGACTTTGATGGGACAAGGGTGTACAGCCCCCCAGAGTGGATCTCTCGACACCAGTACCATGCACTCCCGGCCACTGTCTGGTCACTGGGCATCCTCCTCTATGACATGGTGTGTGGGGACATTCCCTTTGAGAGGGACCAGGAGATTCTGGAAGCTGAGCTCCACTTCCCAGCCCATGTCTCCCCAGACTGCTGTGCCCTAATCCGCCGGTGCCTGGCCCCCAAACCTTCTTCCCGACCCTCACTGGAAGAGATCCTGCTGGACCCCTGGATGCAAACACCAGCCGAGGATGTACCCCTCAACCCCTCCAAAGGAGGCCCTGCCCCTTTGGCCTGGTCCTTGCTACCCTAA
ORF Protein Sequence MLTKPLQGPPAPPGTPTPPPGGKDREAFEAEYRLGPLLGKGGFGTVFAGHRLTDRLQVAIKVIPRNRVLGWSPLSDSVTCPLEVALLWKVGAGGGHPGVIRLLDWFETQEGFMLVLERPLPAQDLFDYITEKGPLGEGPSRCFFGQVVAAIQHCHSRGVVHRDIKDENILIDLRRGCAKLIDFGSGALLHDEPYTDFDGTRVYSPPEWISRHQYHALPATVWSLGILLYDMVCGDIPFERDQEILEAELHFPAHVSPDCCALIRRCLAPKPSSRPSLEEILLDPWMQTPAEDVPLNPSKGGPAPLAWSLLP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0052-Ab Anti-PIM2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0052-Ag PIM2 protein
    ORF Viral Vector pGMLP000986 Human PIM2 Lentivirus plasmid
    ORF Viral Vector pGMLP005248 Human PIM2 Lentivirus plasmid
    ORF Viral Vector vGMLP000986 Human PIM2 Lentivirus particle
    ORF Viral Vector vGMLP005248 Human PIM2 Lentivirus particle


    Target information

    Target ID GM-IP0052
    Target Name PIM2
    Gene ID 11040, 18715, 711844, 317366, 101098037, 442959, 508424, 100062483
    Gene Symbol and Synonyms DXCch3,Pim-2,PIM2
    Uniprot Accession Q9P1W9
    Uniprot Entry Name PIM2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000102096
    Target Classification Kinase

    This gene encodes a protooncogene that acts as a serine/threonine protein kinase. Studies determined the encoded protein functions to prevent apoptosis and to promote cell survival.[provided by RefSeq, Nov 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.