Human MAP2K7/JNKK2/MAPKK7 ORF/cDNA clone-Lentivirus particle (NM_001297556.1)

Cat. No.: vGMLP005310

Pre-made Human MAP2K7/JNKK2/MAPKK7 Lentiviral expression plasmid for MAP2K7 lentivirus packaging, MAP2K7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to MAP2K7/JNKK2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005310 Human MAP2K7 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005310
Gene Name MAP2K7
Accession Number NM_001297556.1
Gene ID 5609
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1281 bp
Gene Alias JNKK2,MAPKK7,MEK,MEK 7,MKK7,PRKMK7,SAPKK-4,SAPKK4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCGTCCTCCCTGGAACAGAAGCTGTCCCGCCTGGAAGCAAAGCTGAAGCAGGAGAACCGGGAGGCCCGGCGGAGGATCGACCTCAACCTGGATATCAGCCCCCAGCGGCCCAGGCCCACCCTGCAGCTCCCGCTGGCCAACGATGGGGGCAGCCGCTCGCCATCCTCAGAGAGCTCCCCGCAGCACCCCACGCCCCCCGCCCGGCCCCGCCACATGCTGGGGCTCCCGTCAACCCTGTTCACACCCCGCAGCATGGAGAGCATTGAGATTGACCAGAAGCTGCAGGAGATCATGAAGCAGACGGGCTACCTGACCATCGGGGGCCAGCGCTACCAGGCAGAAATCAACGACCTGGAGAACTTGGGCGAGATGGGCAGCGGCACCTGCGGCCAGGTGTGGAAGATGCGCTTCCGGAAGACCGGCCACGTCATTGCCGTTAAGCAAATGCGGCGCTCCGGGAACAAGGAGGAGAACAAGCGCATCCTCATGGACCTGGATGTGGTGCTGAAGAGCCACGACTGCCCCTACATCGTGCAGTGCTTTGGGACGTTCATCACCAACACGGACGTCTTCATCGCCATGGAGCTCATGGGCACCTGCGCTGAGAAGCTCAAGAAGCGGATGCAGGGCCCCATCCCCGAGCGCATTCTGGGCAAGATGACAGTGGCGATTGTGAAGGCGCTGTACTACCTGAAGGAGAAGCACGGTGTCATCCACCGCGACGTCAAGCCCTCCAACATCCTGCTGGACGAGCGGGGCCAGATCAAGCTCTGCGACTTCGGCATCAGCGGCCGCCTGGTGGACTCCAAAGCCAAGACGCGGAGCGCCGGCTGTGCCGCCTACATGGCACCCGAGCGCATTGACCCCCCAGACCCCACCAAGCCGGACTATGACATCCGGGCCGACGTATGGAGCCTGGGCATCTCGTTGCCCTGCCCGTCTCCCTCCCAGGTGGAGCTGGCAACAGGACAGTTTCCCTACAAGAACTGCAAGACGGACTTTGAGGTCCTCACCAAAGTCCTACAGGAAGAGCCCCCGCTTCTGCCCGGACACATGGGCTTCTCGGGGGACTTCCAGTCCTTCGTCAAAGACTGCCTTACTAAAGATCACAGGAAGAGACCAAAGTATAATAAGCTACTTGAACACAGCTTCATCAAGCGCTACGAGACGCTGGAGGTGGACGTGGCGTCCTGGTTCAAGGATGTCATGGCGAAGACTGAGTCACCGCGGACTAGCGGCGTCCTGAGCCAGCCCCACCTGCCCTTCTTCAGGTAG
ORF Protein Sequence MAASSLEQKLSRLEAKLKQENREARRRIDLNLDISPQRPRPTLQLPLANDGGSRSPSSESSPQHPTPPARPRHMLGLPSTLFTPRSMESIEIDQKLQEIMKQTGYLTIGGQRYQAEINDLENLGEMGSGTCGQVWKMRFRKTGHVIAVKQMRRSGNKEENKRILMDLDVVLKSHDCPYIVQCFGTFITNTDVFIAMELMGTCAEKLKKRMQGPIPERILGKMTVAIVKALYYLKEKHGVIHRDVKPSNILLDERGQIKLCDFGISGRLVDSKAKTRSAGCAAYMAPERIDPPDPTKPDYDIRADVWSLGISLPCPSPSQVELATGQFPYKNCKTDFEVLTKVLQEEPPLLPGHMGFSGDFQSFVKDCLTKDHRKRPKYNKLLEHSFIKRYETLEVDVASWFKDVMAKTESPRTSGVLSQPHLPFFR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0114-Ab Anti-MAP2K7 monoclonal antibody
    Target Antigen GM-Tg-g-IP0114-Ag MAP2K7 protein
    ORF Viral Vector pGMLP005310 Human MAP2K7 Lentivirus plasmid
    ORF Viral Vector vGMLP005310 Human MAP2K7 Lentivirus particle


    Target information

    Target ID GM-IP0114
    Target Name MAP2K7
    Gene ID 5609, 26400, 710077, 363855, 101095157, 485004, 787278, 100147230
    Gene Symbol and Synonyms 5930412N11Rik,JNKK,JNKK 2,JNKK2,MAP2K7,MAPKK 7,MAPKK7,MEK,MEK 7,Mek7,MKK7,PRKMK7,SAPKK-4,SAPKK4,sek2
    Uniprot Accession O14733
    Uniprot Entry Name MP2K7_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000076984
    Target Classification Kinase

    The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically activates MAPK8/JNK1 and MAPK9/JNK2, and this kinase itself is phosphorylated and activated by MAP kinase kinase kinases including MAP3K1/MEKK1, MAP3K2/MEKK2,MAP3K3/MEKK5, and MAP4K2/GCK. This kinase is involved in the signal transduction mediating the cell responses to proinflammatory cytokines, and environmental stresses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.