Human PHKG2/GSD9C ORF/cDNA clone-Lentivirus particle (NM_000294.2)
Cat. No.: vGMLP005417
Pre-made Human PHKG2/GSD9C Lentiviral expression plasmid for PHKG2 lentivirus packaging, PHKG2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
PHKG2/GSD9C products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP005417 | Human PHKG2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP005417 |
| Gene Name | PHKG2 |
| Accession Number | NM_000294.2 |
| Gene ID | 5261 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1221 bp |
| Gene Alias | GSD9C |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGACGCTGGACGTGGGGCCGGAGGATGAGCTGCCCGACTGGGCCGCCGCCAAAGAGTTTTACCAGAAGTACGACCCTAAGGACGTCATCGGCAGAGGAGTGAGCTCTGTGGTCCGCCGTTGTGTTCATCGAGCTACTGGCCACGAGTTTGCGGTGAAGATTATGGAAGTGACAGCTGAGCGGCTGAGTCCTGAGCAGCTGGAGGAGGTGCGGGAAGCCACACGGCGAGAGACACACATCCTTCGCCAGGTCGCCGGCCACCCCCACATCATCACCCTCATCGATTCCTACGAGTCTTCTAGCTTCATGTTCCTGGTGTTTGACCTGATGCGGAAGGGAGAGCTGTTTGACTATCTCACAGAGAAGGTGGCCCTCTCTGAAAAGGAAACCAGGTCCATCATGCGGTCTCTGCTGGAAGCAGTGAGCTTTCTCCATGCCAACAACATTGTGCATCGAGATCTGAAGCCCGAGAATATTCTCCTAGATGACAATATGCAGATCCGACTTTCAGATTTCGGGTTCTCCTGCCACTTGGAACCTGGCGAGAAGCTTCGAGAGTTGTGTGGGACCCCAGGGTATCTAGCGCCAGAGATCCTTAAATGCTCCATGGATGAAACCCACCCAGGCTATGGCAAGGAGGTCGACCTCTGGGCCTGTGGGGTGATCTTGTTCACACTCCTGGCTGGCTCGCCACCCTTCTGGCACCGGCGGCAGATCCTGATGTTACGCATGATCATGGAGGGCCAGTACCAGTTCAGTTCCCCCGAGTGGGATGACCGTTCCAGCACTGTCAAAGACCTGATCTCCAGGCTGCTGCAGGTGGATCCTGAGGCACGCCTGACAGCTGAGCAGGCCCTACAGCACCCCTTCTTTGAGCGTTGTGAAGGCAGCCAACCCTGGAACCTCACCCCCCGCCAGCGGTTCCGGGTGGCAGTGTGGACAGTGCTGGCTGCTGGACGAGTGGCCCTAAGCACCCATCGTGTACGGCCACTGACCAAGAATGCACTGTTGAGGGACCCTTATGCGCTGCGGTCAGTGCGGCACCTCATCGACAACTGTGCCTTCCGGCTCTACGGGCACTGGGTAAAGAAAGGGGAGCAGCAGAACCGGGCGGCTCTCTTTCAGCACCGGCCCCCTGGGCCTTTTCCCATCATGGGCCCTGAAGAGGAGGGAGACTCTGCTGCTATAACTGAGGATGAGGCCGTGCTTGTGCTGGGCTAG |
| ORF Protein Sequence | MTLDVGPEDELPDWAAAKEFYQKYDPKDVIGRGVSSVVRRCVHRATGHEFAVKIMEVTAERLSPEQLEEVREATRRETHILRQVAGHPHIITLIDSYESSSFMFLVFDLMRKGELFDYLTEKVALSEKETRSIMRSLLEAVSFLHANNIVHRDLKPENILLDDNMQIRLSDFGFSCHLEPGEKLRELCGTPGYLAPEILKCSMDETHPGYGKEVDLWACGVILFTLLAGSPPFWHRRQILMLRMIMEGQYQFSSPEWDDRSSTVKDLISRLLQVDPEARLTAEQALQHPFFERCEGSQPWNLTPRQRFRVAVWTVLAAGRVALSTHRVRPLTKNALLRDPYALRSVRHLIDNCAFRLYGHWVKKGEQQNRAALFQHRPPGPFPIMGPEEEGDSAAITEDEAVLVLG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP0142-Ab | Anti-PHKG2 monoclonal antibody |
| Target Antigen | GM-Tg-g-IP0142-Ag | PHKG2 protein |
| ORF Viral Vector | pGMLP005417 | Human PHKG2 Lentivirus plasmid |
| ORF Viral Vector | vGMLP005417 | Human PHKG2 Lentivirus particle |
Target information
| Target ID | GM-IP0142 |
| Target Name | PHKG2 |
| Gene ID | 5261, 68961, 100423096, 140671, 101092572, 607275, 512670, 100065274 |
| Gene Symbol and Synonyms | 1500017I02Rik,GSD9C,PHKG2 |
| Uniprot Accession | P15735 |
| Uniprot Entry Name | PHKG2_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000156873 |
| Target Classification | Kinase |
Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9C, also known as autosomal liver glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


