Human PHKG2/GSD9C ORF/cDNA clone-Lentivirus particle (NM_000294.2)

Cat. No.: vGMLP005417

Pre-made Human PHKG2/GSD9C Lentiviral expression plasmid for PHKG2 lentivirus packaging, PHKG2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PHKG2/GSD9C products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005417 Human PHKG2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005417
Gene Name PHKG2
Accession Number NM_000294.2
Gene ID 5261
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1221 bp
Gene Alias GSD9C
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACGCTGGACGTGGGGCCGGAGGATGAGCTGCCCGACTGGGCCGCCGCCAAAGAGTTTTACCAGAAGTACGACCCTAAGGACGTCATCGGCAGAGGAGTGAGCTCTGTGGTCCGCCGTTGTGTTCATCGAGCTACTGGCCACGAGTTTGCGGTGAAGATTATGGAAGTGACAGCTGAGCGGCTGAGTCCTGAGCAGCTGGAGGAGGTGCGGGAAGCCACACGGCGAGAGACACACATCCTTCGCCAGGTCGCCGGCCACCCCCACATCATCACCCTCATCGATTCCTACGAGTCTTCTAGCTTCATGTTCCTGGTGTTTGACCTGATGCGGAAGGGAGAGCTGTTTGACTATCTCACAGAGAAGGTGGCCCTCTCTGAAAAGGAAACCAGGTCCATCATGCGGTCTCTGCTGGAAGCAGTGAGCTTTCTCCATGCCAACAACATTGTGCATCGAGATCTGAAGCCCGAGAATATTCTCCTAGATGACAATATGCAGATCCGACTTTCAGATTTCGGGTTCTCCTGCCACTTGGAACCTGGCGAGAAGCTTCGAGAGTTGTGTGGGACCCCAGGGTATCTAGCGCCAGAGATCCTTAAATGCTCCATGGATGAAACCCACCCAGGCTATGGCAAGGAGGTCGACCTCTGGGCCTGTGGGGTGATCTTGTTCACACTCCTGGCTGGCTCGCCACCCTTCTGGCACCGGCGGCAGATCCTGATGTTACGCATGATCATGGAGGGCCAGTACCAGTTCAGTTCCCCCGAGTGGGATGACCGTTCCAGCACTGTCAAAGACCTGATCTCCAGGCTGCTGCAGGTGGATCCTGAGGCACGCCTGACAGCTGAGCAGGCCCTACAGCACCCCTTCTTTGAGCGTTGTGAAGGCAGCCAACCCTGGAACCTCACCCCCCGCCAGCGGTTCCGGGTGGCAGTGTGGACAGTGCTGGCTGCTGGACGAGTGGCCCTAAGCACCCATCGTGTACGGCCACTGACCAAGAATGCACTGTTGAGGGACCCTTATGCGCTGCGGTCAGTGCGGCACCTCATCGACAACTGTGCCTTCCGGCTCTACGGGCACTGGGTAAAGAAAGGGGAGCAGCAGAACCGGGCGGCTCTCTTTCAGCACCGGCCCCCTGGGCCTTTTCCCATCATGGGCCCTGAAGAGGAGGGAGACTCTGCTGCTATAACTGAGGATGAGGCCGTGCTTGTGCTGGGCTAG
ORF Protein Sequence MTLDVGPEDELPDWAAAKEFYQKYDPKDVIGRGVSSVVRRCVHRATGHEFAVKIMEVTAERLSPEQLEEVREATRRETHILRQVAGHPHIITLIDSYESSSFMFLVFDLMRKGELFDYLTEKVALSEKETRSIMRSLLEAVSFLHANNIVHRDLKPENILLDDNMQIRLSDFGFSCHLEPGEKLRELCGTPGYLAPEILKCSMDETHPGYGKEVDLWACGVILFTLLAGSPPFWHRRQILMLRMIMEGQYQFSSPEWDDRSSTVKDLISRLLQVDPEARLTAEQALQHPFFERCEGSQPWNLTPRQRFRVAVWTVLAAGRVALSTHRVRPLTKNALLRDPYALRSVRHLIDNCAFRLYGHWVKKGEQQNRAALFQHRPPGPFPIMGPEEEGDSAAITEDEAVLVLG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0142-Ab Anti-PHKG2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0142-Ag PHKG2 protein
    ORF Viral Vector pGMLP005417 Human PHKG2 Lentivirus plasmid
    ORF Viral Vector vGMLP005417 Human PHKG2 Lentivirus particle


    Target information

    Target ID GM-IP0142
    Target Name PHKG2
    Gene ID 5261, 68961, 100423096, 140671, 101092572, 607275, 512670, 100065274
    Gene Symbol and Synonyms 1500017I02Rik,GSD9C,PHKG2
    Uniprot Accession P15735
    Uniprot Entry Name PHKG2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000156873
    Target Classification Kinase

    Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9C, also known as autosomal liver glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.