Human PDK3/CMTX6/GS1-358P8.4 ORF/cDNA clone-Lentivirus particle (NM_005391.4)

Cat. No.: vGMLP005508

Pre-made Human PDK3/CMTX6/GS1-358P8.4 Lentiviral expression plasmid for PDK3 lentivirus packaging, PDK3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PDHK3/PDK3/CMTX6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005508 Human PDK3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005508
Gene Name PDK3
Accession Number NM_005391.4
Gene ID 5165
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1221 bp
Gene Alias CMTX6,GS1-358P8.4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGGCTGTTCCGGTGGCTGCTGAAGCAGCCGGTGCCCAAGCAGATCGAGCGCTACTCGCGCTTTTCGCCGTCGCCGCTCTCCATCAAACAATTCCTGGACTTCGGGAGAGATAATGCATGTGAGAAAACTTCATATATGTTTCTACGAAAGGAACTTCCTGTGCGGCTGGCTAACACAATGAGAGAAGTTAATCTTCTGCCGGATAATTTACTTAACCGCCCTTCAGTGGGATTGGTTCAGAGTTGGTATATGCAGAGTTTTCTTGAACTTTTAGAATATGAAAATAAGAGCCCTGAGGATCCACAGGTCTTGGATAACTTTCTACAAGTTCTGATTAAAGTCAGAAATAGACACAATGATGTGGTTCCTACAATGGCACAAGGAGTGATTGAATACAAGGAGAAGTTTGGGTTTGATCCTTTCATTAGCACTAACATCCAATATTTTCTGGATCGGTTTTATACCAACCGCATCTCTTTCCGCATGCTTATTAATCAGCACACACTTCTGTTTGGGGGTGACACTAATCCTGTTCATCCTAAACACATAGGAAGTATCGATCCCACCTGTAACGTGGCGGATGTGGTGAAAGATGCATATGAAACAGCCAAGATGCTGTGTGAACAGTATTACCTGGTAGCTCCAGAGCTGGAAGTTGAAGAATTCAATGCCAAAGCGCCAGACAAACCTATTCAGGTGGTTTATGTGCCCTCACATCTGTTTCATATGCTATTTGAGTTGTTCAAGAACTCAATGAGAGCGACAGTTGAACTCTATGAAGACAGAAAAGAGGGCTACCCTGCTGTTAAAACCCTCGTTACTTTGGGTAAAGAAGACTTATCCATTAAGATCAGTGACCTAGGTGGTGGTGTCCCACTTCGAAAAATAGATCGTCTTTTTAACTACATGTATTCTACTGCTCCTAGACCCAGCCTGGAGCCTACCAGAGCTGCCCCTTTGGCTGGATTTGGTTATGGTTTGCCAATTTCCCGTCTGTATGCTAGATATTTTCAAGGAGATCTGAAACTGTATTCCATGGAAGGAGTGGGTACTGATGCTGTCATTTATTTGAAGGCTCTTTCAAGTGAGTCATTTGAGAGACTTCCAGTTTTTAATAAGTCCGCATGGCGCCATTACAAGACCACGCCTGAAGCCGATGATTGGAGCAATCCCAGCAGTGAACCCAGGGATGCTTCAAAATACAAAGCAAAACAGTAA
ORF Protein Sequence MRLFRWLLKQPVPKQIERYSRFSPSPLSIKQFLDFGRDNACEKTSYMFLRKELPVRLANTMREVNLLPDNLLNRPSVGLVQSWYMQSFLELLEYENKSPEDPQVLDNFLQVLIKVRNRHNDVVPTMAQGVIEYKEKFGFDPFISTNIQYFLDRFYTNRISFRMLINQHTLLFGGDTNPVHPKHIGSIDPTCNVADVVKDAYETAKMLCEQYYLVAPELEVEEFNAKAPDKPIQVVYVPSHLFHMLFELFKNSMRATVELYEDRKEGYPAVKTLVTLGKEDLSIKISDLGGGVPLRKIDRLFNYMYSTAPRPSLEPTRAAPLAGFGYGLPISRLYARYFQGDLKLYSMEGVGTDAVIYLKALSSESFERLPVFNKSAWRHYKTTPEADDWSNPSSEPRDASKYKAKQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T99029-Ab Anti-PDHK3 monoclonal antibody
    Target Antigen GM-Tg-g-T99029-Ag PDHK3/PDK3 protein
    ORF Viral Vector pGMLP005508 Human PDK3 Lentivirus plasmid
    ORF Viral Vector vGMLP005508 Human PDK3 Lentivirus particle


    Target information

    Target ID GM-T99029
    Target Name PDHK3
    Gene ID 5165, 236900, 699394, 296849, 101095314, 119868412, 510841, 100060791
    Gene Symbol and Synonyms 2610001M10Rik,CMTX6,GS1-358P8.4,PDK3
    Uniprot Accession Q15120
    Uniprot Entry Name PDK3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000067992
    Target Classification Not Available

    The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.