Human TRIB1/C8FW/GIG-2 ORF/cDNA clone-Lentivirus particle (NM_001282985.1)

Cat. No.: vGMLP005533

Pre-made Human TRIB1/C8FW/GIG-2 Lentiviral expression plasmid for TRIB1 lentivirus packaging, TRIB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TRIB1/C8FW products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005533 Human TRIB1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005533
Gene Name TRIB1
Accession Number NM_001282985.1
Gene ID 10221
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 621 bp
Gene Alias C8FW,GIG-2,GIG2,SKIP1,TRB-1,TRB1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCACTCCTATGTGCGAAGCCGGAAGAGGCTGCGGGAAGAGGAAGCCGCCCGGCTCTTCAAGCAGATTGTCTCCGCCGTCGCCCACTGCCACCAGTCAGCCATCGTGCTGGGGGACCTGAAGCTTAGGAAGTTCGTCTTCTCCACGGAGGAGAGAACCCAGCTTAGACTAGAAAGTCTAGAAGACACACACATAATGAAGGGGGAAGATGATGCTTTGTCAGACAAACATGGCTGCCCAGCCTACGTGAGCCCTGAGATCCTCAACACCACTGGGACCTACTCCGGAAAGGCTGCGGACGTTTGGAGCCTGGGGGTGATGCTCTACACCCTTCTGGTTGGACGATACCCCTTCCATGACTCAGACCCCAGTGCCCTTTTCTCCAAAATTCGGCGTGGACAGTTCTGCATTCCTGAGCACATTTCCCCCAAAGCCAGGTGCCTCATTCGCAGCCTCTTGAGACGGGAGCCCTCCGAGAGACTCACTGCCCCCGAGATCCTACTGCACCCCTGGTTTGAGTCCGTCTTGGAACCCGGGTACATCGACTCAGAAATAGGAACTTCAGACCAGATTGTTCCAGAGTACCAGGAGGACAGTGACATTAGTTCCTTCTTCTGCTAA
ORF Protein Sequence MHSYVRSRKRLREEEAARLFKQIVSAVAHCHQSAIVLGDLKLRKFVFSTEERTQLRLESLEDTHIMKGEDDALSDKHGCPAYVSPEILNTTGTYSGKAADVWSLGVMLYTLLVGRYPFHDSDPSALFSKIRRGQFCIPEHISPKARCLIRSLLRREPSERLTAPEILLHPWFESVLEPGYIDSEIGTSDQIVPEYQEDSDISSFFC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2777-Ab Anti-TRIB1 monoclonal antibody
    Target Antigen GM-Tg-g-IP2777-Ag TRIB1 protein
    ORF Viral Vector pGMLP001592 Human TRIB1 Lentivirus plasmid
    ORF Viral Vector pGMLP005533 Human TRIB1 Lentivirus plasmid
    ORF Viral Vector vGMLP001592 Human TRIB1 Lentivirus particle
    ORF Viral Vector vGMLP005533 Human TRIB1 Lentivirus particle


    Target information

    Target ID GM-IP2777
    Target Name TRIB1
    Gene ID 10221, 211770, 693459, 78969, 101087043, 482039, 521857, 100033926
    Gene Symbol and Synonyms A530090O15Rik,C8FW,GIG-2,GIG2,SKIP1,TRB-1,TRB1,TRIB1
    Uniprot Accession Q96RU8
    Uniprot Entry Name TRIB1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000173334
    Target Classification Not Available

    Enables mitogen-activated protein kinase kinase binding activity and protein kinase inhibitor activity. Involved in several processes, including JNK cascade; negative regulation of lipopolysaccharide-mediated signaling pathway; and regulation of protein kinase activity. Located in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.