Human PRKAR2B/PRKAR2/RII-BETA ORF/cDNA clone-Lentivirus particle (NM_002736.2)

Cat. No.: vGMLP005548

Pre-made Human PRKAR2B/PRKAR2/RII-BETA Lentiviral expression plasmid for PRKAR2B lentivirus packaging, PRKAR2B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PRKAR2B/PRKAR2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005548 Human PRKAR2B Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005548
Gene Name PRKAR2B
Accession Number NM_002736.2
Gene ID 5577
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1257 bp
Gene Alias PRKAR2,RII-BETA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCATCGAGATCCCGGCGGGACTGACGGAGCTGCTGCAGGGCTTCACGGTGGAGGTGCTGAGGCACCAGCCCGCGGACCTGCTGGAGTTCGCGCTGCAGCACTTCACCCGCCTGCAGCAGGAGAACGAGCGCAAAGGCACCGCGCGCTTCGGCCATGAGGGCAGGACCTGGGGGGACCTGGGCGCCGCTGCCGGGGGCGGCACCCCCAGCAAGGGGGTCAACTTCGCCGAGGAGCCCATGCAGTCCGACTCCGAGGACGGGGAGGAGGAGGAGGCGGCGCCCGCGGACGCAGGGGCGTTCAATGCTCCAGTAATAAACCGATTCACAAGGCGTGCCTCAGTATGTGCAGAAGCTTATAATCCTGATGAAGAAGAAGATGATGCAGAGTCCAGGATTATACATCCAAAAACTGATGATCAAAGAAATAGGTTGCAAGAGGCTTGCAAAGACATCCTGCTGTTTAAGAATCTGGATCCGGAGCAGATGTCTCAAGTATTAGATGCCATGTTTGAAAAATTGGTCAAAGATGGGGAGCATGTAATTGATCAAGGTGACGATGGTGACAACTTTTATGTAATTGATAGAGGCACATTTGATATTTATGTGAAATGTGATGGTGTTGGAAGATGTGTTGGTAACTATGATAATCGTGGGAGTTTCGGCGAACTGGCCTTAATGTACAATACACCCAGAGCAGCTACAATCACTGCTACCTCTCCTGGTGCTCTGTGGGGTTTGGACAGGGTAACCTTCAGGAGAATAATTGTGAAAAACAATGCCAAAAAGAGAAAAATGTATGAAAGCTTTATTGAGTCACTGCCATTCCTTAAATCTTTGGAGTTTTCTGAACGCCTGAAAGTAGTAGATGTGATAGGCACCAAAGTATACAACGATGGAGAACAAATCATTGCTCAGGGAGATTCGGCTGATTCTTTTTTCATTGTAGAATCTGGAGAAGTGAAAATTACTATGAAAAGAAAGGGTAAATCAGAAGTGGAAGAGAATGGTGCAGTAGAAATCGCTCGATGCTCGCGGGGACAGTACTTTGGAGAGCTTGCCCTGGTAACTAACAAACCTCGAGCAGCTTCTGCCCACGCCATTGGGACTGTCAAATGTTTAGCAATGGATGTGCAAGCATTTGAAAGGCTTCTGGGACCTTGCATGGAAATTATGAAAAGGAACATCGCTACCTATGAAGAACAGTTAGTTGCCCTGTTTGGAACGAACATGGATATTGTTGAACCCACTGCATGA
ORF Protein Sequence MSIEIPAGLTELLQGFTVEVLRHQPADLLEFALQHFTRLQQENERKGTARFGHEGRTWGDLGAAAGGGTPSKGVNFAEEPMQSDSEDGEEEEAAPADAGAFNAPVINRFTRRASVCAEAYNPDEEEDDAESRIIHPKTDDQRNRLQEACKDILLFKNLDPEQMSQVLDAMFEKLVKDGEHVIDQGDDGDNFYVIDRGTFDIYVKCDGVGRCVGNYDNRGSFGELALMYNTPRAATITATSPGALWGLDRVTFRRIIVKNNAKKRKMYESFIESLPFLKSLEFSERLKVVDVIGTKVYNDGEQIIAQGDSADSFFIVESGEVKITMKRKGKSEVEENGAVEIARCSRGQYFGELALVTNKPRAASAHAIGTVKCLAMDVQAFERLLGPCMEIMKRNIATYEEQLVALFGTNMDIVEPTA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T74952-Ab Anti-PRKAR2B monoclonal antibody
    Target Antigen GM-Tg-g-T74952-Ag PRKAR2B protein
    ORF Viral Vector pGMLP005548 Human PRKAR2B Lentivirus plasmid
    ORF Viral Vector vGMLP005548 Human PRKAR2B Lentivirus particle


    Target information

    Target ID GM-T74952
    Target Name PRKAR2B
    Gene ID 5577, 19088, 700770, 24679, 101081127, 475887, 282463, 100060030
    Gene Symbol and Synonyms Pkarb2,PKARIIbeta,PRKAR2,PRKAR2B,RATDNA,RII(beta),RII-BETA
    Uniprot Accession P31323
    Uniprot Entry Name KAP3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000005249
    Target Classification Not Available

    cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.