Human CAPS/CAPS1 ORF/cDNA clone-Lentivirus particle (NM_004058.4)

Cat. No.: vGMLV000249

Pre-made Human CAPS/CAPS1 Lentiviral expression plasmid for CAPS lentivirus packaging, CAPS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CAPS/CAPS1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000249 Human CAPS Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000249
Gene Name CAPS
Accession Number NM_004058.4
Gene ID 828
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 828 bp
Gene Alias CAPS1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCAGTGCCACAGGGATCTGGCTCTGTCCCAGGCCCTGTGGGGCTGGCAGTTGAGTAAGCAGTCAGGCTGGGCGCACCCATCCCTCCCCCACTCCCCACTGCCCAGCACAGTGCATTCATGCAGCTGGGCCCCACCCCATCTCCAGAGGCACCTTCCACTAGCAACAGTCTCCCCAGGCACAACACAGCTAACACAAGGCCCCGCAGGCAGGACTCTGGGACAGACGCAGGCCAGCTGCCCAGAGCCCAGACCAAGCATGGACGCCGTGGATGCCACCATGGAGAAACTCCGGGCACAGTGCCTGTCCCGCGGGGCCTCGGGCATCCAGGGCCTGGCCAGGTTTTTCCGCCAACTAGACCGGGACGGGAGCAGATCCCTGGACGCTGATGAGTTCCGGCAGGGTCTGGCCAAACTCGGGCTGGTGCTGGACCAGGCGGAGGCAGAGGGTGTGTGCAGGAAGTGGGACCGCAATGGCAGCGGGACGCTGGATCTGGAGGAGTTCCTTCGGGCGCTGCGGCCCCCCATGTCCCAGGCCCGGGAGGCTGTCATCGCAGCTGCATTTGCCAAGCTGGACCGCAGTGGGGACGGCGTCGTGACGGTGGACGACCTCCGCGGGGTGTACAGTGGCCGTGCCCACCCCAAGGTGCGCAGTGGGGAGTGGACCGAGGACGAGGTGCTGCGCCGCTTCCTGGACAACTTCGACTCCTCTGAGAAGGACGGGCAGGTCACACTGGCGGAATTCCAGGACTACTACAGCGGCGTGAGTGCCTCCATGAACACGGATGAGGAGTTCGTGGCCATGATGACCAGTGCCTGGCAGCTGTGA
ORF Protein Sequence MQCHRDLALSQALWGWQLSKQSGWAHPSLPHSPLPSTVHSCSWAPPHLQRHLPLATVSPGTTQLTQGPAGRTLGQTQASCPEPRPSMDAVDATMEKLRAQCLSRGASGIQGLARFFRQLDRDGSRSLDADEFRQGLAKLGLVLDQAEAEGVCRKWDRNGSGTLDLEEFLRALRPPMSQAREAVIAAAFAKLDRSGDGVVTVDDLRGVYSGRAHPKVRSGEWTEDEVLRRFLDNFDSSEKDGQVTLAEFQDYYSGVSASMNTDEEFVAMMTSAWQL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2396-Ab Anti-CAPS monoclonal antibody
    Target Antigen GM-Tg-g-IP2396-Ag CAPS protein
    ORF Viral Vector pGMLV000249 Human CAPS Lentivirus plasmid
    ORF Viral Vector vGMLV000249 Human CAPS Lentivirus particle


    Target information

    Target ID GM-IP2396
    Target Name CAPS
    Gene ID 828, 700767, 120094827, 101094401, 403965, 616482, 100065259
    Gene Symbol and Synonyms CAPS,CAPS1
    Uniprot Accession Q13938
    Uniprot Entry Name CAYP1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000105519
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a calcium-binding protein, which may play a role in the regulation of ion transport. A similar protein was first described as a potentially important regulatory protein in the dog thyroid and was termed as R2D5 antigen in rabbit. Alternative splicing of this gene generates two transcript variants. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.