Human CAPS/CAPS1 ORF/cDNA clone-Lentivirus particle (NM_004058.4)
Cat. No.: vGMLV000249
Pre-made Human CAPS/CAPS1 Lentiviral expression plasmid for CAPS lentivirus packaging, CAPS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CAPS/CAPS1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV000249 | Human CAPS Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV000249 |
Gene Name | CAPS |
Accession Number | NM_004058.4 |
Gene ID | 828 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 828 bp |
Gene Alias | CAPS1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCAGTGCCACAGGGATCTGGCTCTGTCCCAGGCCCTGTGGGGCTGGCAGTTGAGTAAGCAGTCAGGCTGGGCGCACCCATCCCTCCCCCACTCCCCACTGCCCAGCACAGTGCATTCATGCAGCTGGGCCCCACCCCATCTCCAGAGGCACCTTCCACTAGCAACAGTCTCCCCAGGCACAACACAGCTAACACAAGGCCCCGCAGGCAGGACTCTGGGACAGACGCAGGCCAGCTGCCCAGAGCCCAGACCAAGCATGGACGCCGTGGATGCCACCATGGAGAAACTCCGGGCACAGTGCCTGTCCCGCGGGGCCTCGGGCATCCAGGGCCTGGCCAGGTTTTTCCGCCAACTAGACCGGGACGGGAGCAGATCCCTGGACGCTGATGAGTTCCGGCAGGGTCTGGCCAAACTCGGGCTGGTGCTGGACCAGGCGGAGGCAGAGGGTGTGTGCAGGAAGTGGGACCGCAATGGCAGCGGGACGCTGGATCTGGAGGAGTTCCTTCGGGCGCTGCGGCCCCCCATGTCCCAGGCCCGGGAGGCTGTCATCGCAGCTGCATTTGCCAAGCTGGACCGCAGTGGGGACGGCGTCGTGACGGTGGACGACCTCCGCGGGGTGTACAGTGGCCGTGCCCACCCCAAGGTGCGCAGTGGGGAGTGGACCGAGGACGAGGTGCTGCGCCGCTTCCTGGACAACTTCGACTCCTCTGAGAAGGACGGGCAGGTCACACTGGCGGAATTCCAGGACTACTACAGCGGCGTGAGTGCCTCCATGAACACGGATGAGGAGTTCGTGGCCATGATGACCAGTGCCTGGCAGCTGTGA |
ORF Protein Sequence | MQCHRDLALSQALWGWQLSKQSGWAHPSLPHSPLPSTVHSCSWAPPHLQRHLPLATVSPGTTQLTQGPAGRTLGQTQASCPEPRPSMDAVDATMEKLRAQCLSRGASGIQGLARFFRQLDRDGSRSLDADEFRQGLAKLGLVLDQAEAEGVCRKWDRNGSGTLDLEEFLRALRPPMSQAREAVIAAAFAKLDRSGDGVVTVDDLRGVYSGRAHPKVRSGEWTEDEVLRRFLDNFDSSEKDGQVTLAEFQDYYSGVSASMNTDEEFVAMMTSAWQL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP2396-Ab | Anti-CAPS monoclonal antibody |
Target Antigen | GM-Tg-g-IP2396-Ag | CAPS protein |
ORF Viral Vector | pGMLV000249 | Human CAPS Lentivirus plasmid |
ORF Viral Vector | vGMLV000249 | Human CAPS Lentivirus particle |
Target information
Target ID | GM-IP2396 |
Target Name | CAPS |
Gene ID | 828, 700767, 120094827, 101094401, 403965, 616482, 100065259 |
Gene Symbol and Synonyms | CAPS,CAPS1 |
Uniprot Accession | Q13938 |
Uniprot Entry Name | CAYP1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000105519 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a calcium-binding protein, which may play a role in the regulation of ion transport. A similar protein was first described as a potentially important regulatory protein in the dog thyroid and was termed as R2D5 antigen in rabbit. Alternative splicing of this gene generates two transcript variants. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.