Human MMP1/CLG/ CLGN ORF/cDNA clone-Lentivirus particle (NM_002421.3)

Pre-made Human MMP1/CLG/ CLGN Lentiviral expression plasmid for MMP1 lentivirus packaging, MMP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to MMP-1/MMP1/CLG products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000920 Human MMP1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000920
Gene Name MMP1
Accession Number NM_002421.3
Gene ID 4312
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1410 bp
Gene Alias CLG, CLGN
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCACAGCTTTCCTCCACTGCTGCTGCTGCTGTTCTGGGGTGTGGTGTCTCACAGCTTCCCAGCGACTCTAGAAACACAAGAGCAAGATGTGGACTTAGTCCAGAAATACCTGGAAAAATACTACAACCTGAAGAATGATGGGAGGCAAGTTGAAAAGCGGAGAAATAGTGGCCCAGTGGTTGAAAAATTGAAGCAAATGCAGGAATTCTTTGGGCTGAAAGTGACTGGGAAACCAGATGCTGAAACCCTGAAGGTGATGAAGCAGCCCAGATGTGGAGTGCCTGATGTGGCTCAGTTTGTCCTCACTGAGGGGAACCCTCGCTGGGAGCAAACACATCTGACCTACAGGATTGAAAATTACACGCCAGATTTGCCAAGAGCAGATGTGGACCATGCCATTGAGAAAGCCTTCCAACTCTGGAGTAATGTCACACCTCTGACATTCACCAAGGTCTCTGAGGGTCAAGCAGACATCATGATATCTTTTGTCAGGGGAGATCATCGGGACAACTCTCCTTTTGATGGACCTGGAGGAAATCTTGCTCATGCTTTTCAACCAGGCCCAGGTATTGGAGGGGATGCTCATTTTGATGAAGATGAAAGGTGGACCAACAATTTCAGAGAGTACAACTTACATCGTGTTGCAGCTCATGAACTCGGCCATTCTCTTGGACTCTCCCATTCTACTGATATCGGGGCTTTGATGTACCCTAGCTACACCTTCAGTGGTGATGTTCAGCTAGCTCAGGATGACATTGATGGCATCCAAGCCATATATGGACGTTCCCAAAATCCTGTCCAGCCCATCGGCCCACAAACCCCAAAAGCGTGTGACAGTAAGCTAACCTTTGATGCTATAACTACGATTCGGGGAGAAGTGATGTTCTTTAAAGACAGATTCTACATGCGCACAAATCCCTTCTACCCGGAAGTTGAGCTCAATTTCATTTCTGTTTTCTGGCCACAACTGCCAAATGGGCTTGAAGCTGCTTACGAATTTGCCGACAGAGATGAAGTCCGGTTTTTCAAAGGGAATAAGTACTGGGCTGTTCAGGGACAGAATGTGCTACACGGATACCCCAAGGACATCTACAGCTCCTTTGGCTTCCCTAGAACTGTGAAGCATATCGATGCTGCTCTTTCTGAGGAAAACACTGGAAAAACCTACTTCTTTGTTGCTAACAAATACTGGAGGTATGATGAATATAAACGATCTATGGATCCAGGTTATCCCAAAATGATAGCACATGACTTTCCTGGAATTGGCCACAAAGTTGATGCAGTTTTCATGAAAGATGGATTTTTCTATTTCTTTCATGGAACAAGACAATACAAATTTGATCCTAAAACGAAGAGAATTTTGACTCTCCAGAAAGCTAATAGCTGGTTCAACTGCAGGAAAAATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T52450-Ab Anti-MMP1/ MMP-1/ CLG functional antibody
    Target Antigen GM-Tg-g-T52450-Ag MMP-1/MMP1 protein
    ORF Viral Vector pGMLV000290 Human MMP1 Lentivirus plasmid
    ORF Viral Vector pGMLV000920 Human MMP1 Lentivirus plasmid
    ORF Viral Vector vGMLV000290 Human MMP1 Lentivirus particle
    ORF Viral Vector vGMLV000920 Human MMP1 Lentivirus particle


    Target information

    Target ID GM-T52450
    Target Name MMP-1
    Gene ID 4312, 703653, 489428, 100033896
    Gene Symbol and Synonyms CLG,CLGN,MMP-1,MMP1
    Uniprot Accession P03956
    Uniprot Entry Name MMP1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Breast Cancer, Intrahepatic bile duct carcinoma
    Gene Ensembl ENSG00000196611
    Target Classification Not Available

    This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down the interstitial collagens, including types I, II, and III. The gene is part of a cluster of MMP genes on chromosome 11. Mutations in this gene are associated with chronic obstructive pulmonary disease (COPD). Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.