Human IDH3A/RP90 ORF/cDNA clone-Lentivirus particle (NM_005530.3)

Cat. No.: vGMLV001152

Pre-made Human IDH3A/RP90 Lentiviral expression plasmid for IDH3A lentivirus packaging, IDH3A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to IDH3A/RP90 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001152 Human IDH3A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001152
Gene Name IDH3A
Accession Number NM_005530.3
Gene ID 3419
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1101 bp
Gene Alias RP90
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTGGGCCCGCGTGGATCTCTAAGGTCTCTCGGCTGCTGGGGGCATTCCACAACCCAAAACAGGTGACCAGAGGTTTTACTGGTGGTGTTCAGACAGTAACTTTAATTCCAGGAGATGGTATTGGCCCAGAAATTTCAGCTGCAGTTATGAAGATTTTTGATGCTGCCAAAGCACCTATTCAGTGGGAGGAGCGGAACGTCACTGCCATTCAAGGACCTGGAGGAAAGTGGATGATCCCTTCAGAGGCTAAAGAGTCCATGGATAAGAACAAGATGGGCTTGAAAGGCCCTTTGAAGACCCCAATAGCAGCCGGTCACCCATCTATGAATTTACTGCTGCGCAAAACATTTGACCTTTACGCGAATGTCCGACCATGTGTCTCTATCGAAGGCTATAAAACCCCTTACACCGATGTAAATATTGTGACCATTCGAGAGAACACAGAAGGAGAATACAGTGGAATTGAGCATGTGATTGTTGATGGAGTCGTGCAGAGTATCAAGCTCATCACCGAGGGGGCGAGCAAGCGCATTGCTGAGTTTGCCTTTGAGTATGCCCGGAACAACCACCGGAGCAACGTCACGGCGGTGCACAAAGCCAACATCATGCGGATGTCAGATGGGCTTTTTCTACAAAAATGCAGGGAAGTTGCAGAAAGCTGTAAAGATATTAAATTTAATGAGATGTACCTTGATACAGTATGTTTGAATATGGTACAAGATCCTTCCCAATTTGATGTTCTTGTTATGCCAAATTTGTATGGAGACATCCTTAGTGACTTGTGTGCAGGATTGATCGGAGGTCTCGGTGTGACACCAAGTGGCAACATTGGAGCCAATGGGGTTGCAATTTTTGAGTCGGTTCATGGGACGGCTCCAGACATTGCAGGCAAGGACATGGCGAATCCCACAGCCCTCCTGCTCAGTGCCGTGATGATGCTGCGCCACATGGGACTTTTTGACCATGCTGCAAGAATTGAGGCTGCGTGTTTTGCTACAATTAAGGACGGAAAGAGCTTGACAAAAGATTTGGGAGGCAATGCAAAATGCTCAGACTTCACAGAGGAAATCTGTCGCCGAGTAAAAGATTTAGATTAA
ORF Protein Sequence MAGPAWISKVSRLLGAFHNPKQVTRGFTGGVQTVTLIPGDGIGPEISAAVMKIFDAAKAPIQWEERNVTAIQGPGGKWMIPSEAKESMDKNKMGLKGPLKTPIAAGHPSMNLLLRKTFDLYANVRPCVSIEGYKTPYTDVNIVTIRENTEGEYSGIEHVIVDGVVQSIKLITEGASKRIAEFAFEYARNNHRSNVTAVHKANIMRMSDGLFLQKCREVAESCKDIKFNEMYLDTVCLNMVQDPSQFDVLVMPNLYGDILSDLCAGLIGGLGVTPSGNIGANGVAIFESVHGTAPDIAGKDMANPTALLLSAVMMLRHMGLFDHAARIEAACFATIKDGKSLTKDLGGNAKCSDFTEEICRRVKDLD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA143-Ab Anti-IDH3A monoclonal antibody
    Target Antigen GM-Tg-g-TA143-Ag IDH3A protein
    ORF Viral Vector pGMLV001152 Human IDH3A Lentivirus plasmid
    ORF Viral Vector vGMLV001152 Human IDH3A Lentivirus particle


    Target information

    Target ID GM-TA143
    Target Name IDH3A
    Gene ID 3419, 67834, 677715, 114096, 101085721, 479066, 282446, 100060114
    Gene Symbol and Synonyms 1110003P10Rik,1500012E04Rik,BG1,IDH3A,RP90
    Uniprot Accession P50213
    Uniprot Entry Name IDH3A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000166411
    Target Classification Not Available

    Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the alpha subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.