Human PRMT1/ANM1/HCP1 ORF/cDNA clone-Lentivirus particle (NM_001536.6)

Cat. No.: vGMLV001540

Pre-made Human PRMT1/ANM1/HCP1 Lentiviral expression plasmid for PRMT1 lentivirus packaging, PRMT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PRMT1/ANM1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001540 Human PRMT1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001540
Gene Name PRMT1
Accession Number NM_001536.6
Gene ID 3276
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1116 bp
Gene Alias ANM1,HCP1,HRMT1L2,IR1B4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCAGCCGAGGCCGCGAACTGCATCATGGAGAATTTTGTAGCCACCTTGGCTAATGGGATGAGCCTCCAGCCGCCTCTTGAAGAAGTGTCCTGTGGCCAGGCGGAAAGCAGTGAGAAGCCCAACGCTGAGGACATGACATCCAAAGATTACTACTTTGACTCCTACGCACACTTTGGCATCCACGAGGAGATGCTGAAGGACGAGGTGCGCACCCTCACTTACCGCAACTCCATGTTTCATAACCGGCACCTCTTCAAGGACAAGGTGGTGCTGGACGTCGGCTCGGGCACCGGCATCCTCTGCATGTTTGCTGCCAAGGCCGGGGCCCGCAAGGTCATCGGGATCGAGTGTTCCAGTATCTCTGATTATGCGGTGAAGATCGTCAAAGCCAACAAGTTAGACCACGTGGTGACCATCATCAAGGGGAAGGTGGAGGAGGTGGAGCTCCCAGTGGAGAAGGTGGACATCATCATCAGCGAGTGGATGGGCTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTCTATGCCCGGGACAAGTGGCTGGCGCCCGATGGCCTCATCTTCCCAGACCGGGCCACGCTGTATGTGACGGCCATCGAGGACCGGCAGTACAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTCGACATGTCTTGCATCAAAGATGTGGCCATTAAGGAGCCCCTAGTGGATGTCGTGGACCCCAAACAGCTGGTCACCAACGCCTGCCTCATAAAGGAGGTGGACATCTATACCGTCAAGGTGGAAGACCTGACCTTCACCTCCCCGTTCTGCCTGCAAGTGAAGCGGAATGACTACGTGCACGCCCTGGTGGCCTACTTCAACATCGAGTTCACACGCTGCCACAAGAGGACCGGCTTCTCCACCAGCCCCGAGTCCCCGTACACGCACTGGAAGCAGACGGTGTTCTACATGGAGGACTACCTGACCGTGAAGACGGGCGAGGAGATCTTCGGCACCATCGGCATGCGGCCCAACGCCAAGAACAACCGGGACCTGGACTTCACCATCGACCTGGACTTCAAGGGCCAGCTGTGCGAGCTGTCCTGCTCCACCGACTACCGGATGCGCTGA
ORF Protein Sequence MAAAEAANCIMENFVATLANGMSLQPPLEEVSCGQAESSEKPNAEDMTSKDYYFDSYAHFGIHEEMLKDEVRTLTYRNSMFHNRHLFKDKVVLDVGSGTGILCMFAAKAGARKVIGIECSSISDYAVKIVKANKLDHVVTIIKGKVEEVELPVEKVDIIISEWMGYCLFYESMLNTVLYARDKWLAPDGLIFPDRATLYVTAIEDRQYKDYKIHWWENVYGFDMSCIKDVAIKEPLVDVVDPKQLVTNACLIKEVDIYTVKVEDLTFTSPFCLQVKRNDYVHALVAYFNIEFTRCHKRTGFSTSPESPYTHWKQTVFYMEDYLTVKTGEEIFGTIGMRPNAKNNRDLDFTIDLDFKGQLCELSCSTDYRMR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T16808-Ab Anti-PRMT1 monoclonal antibody
    Target Antigen GM-Tg-g-T16808-Ag PRMT1 protein
    ORF Viral Vector pGMLV001540 Human PRMT1 Lentivirus plasmid
    ORF Viral Vector vGMLV001540 Human PRMT1 Lentivirus particle


    Target information

    Target ID GM-T16808
    Target Name PRMT1
    Gene ID 3276, 15469, 719419, 60421, 101095389, 476411, 520388, 100052097
    Gene Symbol and Synonyms 6720434D09Rik,ANM1,HCP1,HRMT1L2,IR1B4,Mrmt1,PRMT1
    Uniprot Accession Q99873
    Uniprot Entry Name ANM1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Ovary Cancer
    Gene Ensembl ENSG00000126457
    Target Classification Not Available

    This gene encodes a member of the protein arginine N-methyltransferase (PRMT) family. Post-translational modification of target proteins by PRMTs plays an important regulatory role in many biological processes, whereby PRMTs methylate arginine residues by transferring methyl groups from S-adenosyl-L-methionine to terminal guanidino nitrogen atoms. The encoded protein is a type I PRMT and is responsible for the majority of cellular arginine methylation activity. Increased expression of this gene may play a role in many types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.