Human CCL2/GDCF-2/HC11 ORF/cDNA clone-Lentivirus particle (NM_002982.4)
Cat. No.: vGMLV001954
Pre-made Human CCL2/GDCF-2/HC11 Lentiviral expression plasmid for CCL2 lentivirus packaging, CCL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
CCL2/GDCF-2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLV001954 | Human CCL2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLV001954 |
| Gene Name | CCL2 |
| Accession Number | NM_002982.4 |
| Gene ID | 6347 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 300 bp |
| Gene Alias | GDCF-2,HC11,HSMCR30,MCAF,MCP-1,MCP1,SCYA2,SMC-CF |
| Fluorescent Reporter | Firefly luciferase |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAAAGTCTCTGCCGCCCTTCTGTGCCTGCTGCTCATAGCAGCCACCTTCATTCCCCAAGGGCTCGCTCAGCCAGATGCAATCAATGCCCCAGTCACCTGCTGTTATAACTTCACCAATAGGAAGATCTCAGTGCAGAGGCTCGCGAGCTATAGAAGAATCACCAGCAGCAAGTGTCCCAAAGAAGCTGTGATCTTCAAGACCATTGTGGCCAAGGAGATCTGTGCTGACCCCAAGCAGAAGTGGGTTCAGGATTCCATGGACCACCTGGACAAGCAAACCCAAACTCCGAAGACTTGA |
| ORF Protein Sequence | MKVSAALLCLLLIAATFIPQGLAQPDAINAPVTCCYNFTNRKISVQRLASYRRITSSKCPKEAVIFKTIVAKEICADPKQKWVQDSMDHLDKQTQTPKT |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-094 | Pre-Made Carlumab biosimilar, Whole mAb, Anti-CCL2 Antibody: Anti-HC11/MCAF/MCP1/MCP-1/SCYA2/GDCF-2/SMC-CF/HSMCR30 therapeutic antibody |
| Target Antibody | GM-Tg-g-T11309-Ab | Anti-CCL2/ GDCF-2/ HC11 functional antibody |
| Target Antigen | GM-Tg-g-T11309-Ag | CCL2 protein |
| Cytokine | cks-Tg-g-GM-T11309 | chemokine (C-C motif) ligand 2 (CCL2) protein & antibody |
| ORF Viral Vector | pGMLP000392 | Human CCL2 Lentivirus plasmid |
| ORF Viral Vector | pGMLP005505 | Human CCL2 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001561 | Human CCL2 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001954 | Human CCL2 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000030 | Human CCL2 Adenovirus plasmid |
| ORF Viral Vector | vGMLP000392 | Human CCL2 Lentivirus particle |
| ORF Viral Vector | vGMLP005505 | Human CCL2 Lentivirus particle |
| ORF Viral Vector | vGMLV001561 | Human CCL2 Lentivirus particle |
| ORF Viral Vector | vGMLV001954 | Human CCL2 Lentivirus particle |
| ORF Viral Vector | vGMAP000030 | Human CCL2 Adenovirus particle |
Target information
| Target ID | GM-T11309 |
| Target Name | CCL2 |
| Gene ID | 6347, 20296, 574138 |
| Gene Symbol and Synonyms | CCL2,GDCF-2,HC11,HSMCR30,JE,MCAF,MCP-1,MCP1,SCYA2,Sigje,SMC-CF |
| Uniprot Accession | P13500 |
| Uniprot Entry Name | CCL2_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
| Disease | Breast Cancer, Systemic lupus erythematosus (SLE), Idiopathic hypoparathyroidism, IgA glomerulonephritis, Lupus Glomerulonephritis, Nephrotic syndrome, Nephrotic syndrome with focal and segmental glomerular lesions, Overactive bladder, Proteinuria, Renal fibrosis, Schistosomiasis, Tubulo-interstitial nephropathy in systemic lupus erythematosus, Urolithiasis, Vasculitis, Autosomal Dominant Polycystic Kidney Disease, Bacterial sepsis of newborn, Chronic Kidney Disease, Congenital hydronephrosis, Congenital occlusion of ureteropelvic junction, Diabetic Nephropathy, Glomerulonephritis, Hepatic fibrosis, Hydronephrosis with renal and ureteral calculous obstruction, Hypertension, Type 2 diabetes mellitus with diabetic nephropathy, breast cancer |
| Gene Ensembl | ENSG00000108691 |
| Target Classification | Checkpoint-Immuno Oncology |
This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Chemokines are a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes and basophils but not for neutrophils or eosinophils. It has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, like psoriasis, rheumatoid arthritis and atherosclerosis. It binds to chemokine receptors CCR2 and CCR4. Elevated expression of the encoded protein is associated with severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) infection. [provided by RefSeq, Aug 2020]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


