Human PROZ/PZ ORF/cDNA clone-Lentivirus particle (NM_003891.3)
Cat. No.: vGMLV002109
Pre-made Human PROZ/PZ Lentiviral expression plasmid for PROZ lentivirus packaging, PROZ lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
PROZ/PZ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLV002109 | Human PROZ Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLV002109 |
| Gene Name | PROZ |
| Accession Number | NM_003891.3 |
| Gene ID | 8858 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1203 bp |
| Gene Alias | PZ |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCAGGCTGCGTCCCACTGCTCCAGGGCCTGGTCCTGGTCCTCGCCCTCCATCGTGTGGAGCCCTCAGTATTTCTCCCGGCCTCCAAAGCAAACGACGTTCTGGTGAGGTGGAAGCGTGCGGGCTCCTATCTTCTGGAAGAACTCTTCGAGGGAAACTTGGAAAAAGAATGTTATGAAGAAATCTGTGTCTATGAAGAAGCAAGAGAAGTGTTTGAAAATGAAGTAGTCACTGATGAATTCTGGAGACGATATAAGGGCGGCTCCCCGTGCATCTCCCAGCCCTGCCTCCACAACGGCTCTTGCCAGGACAGCATCTGGGGCTACACCTGCACCTGCTCCCCCGGCTATGAGGGCAGCAACTGCGAGCTGGCTAAAAATGAATGTCACCCAGAGCGGACTGATGGGTGTCAACACTTCTGCCTCCCAGGACAGGAATCCTACACATGCAGCTGTGCTCAGGGCTACAGGCTTGGTGAGGACCACAAACAGTGTGTGCCCCACGACCAGTGTGCCTGCGGGGTGCTGACCTCTGAGAAGCGTGCACCGGATCTACAGGACCTCCCGTGGCAGGTAAAGTTAACAAATTCCGAAGGAAAAGACTTCTGTGGTGGTGTTATAATACGGGAAAATTTTGTACTGACAACAGCAAAATGTTCACTGTTACACAGGAATATTACTGTAAAAACATATTTTAACAGAACGAGCCAAGACCCGCTGATGATCAAGATAACGCACGTCCATGTGCACATGCGGTATGACGCGGACGCGGGGGAGAATGACCTGTCACTGCTGGAGCTGGAGTGGCCCATCCAGTGCCCAGGTGCGGGGCTCCCCGTGTGCACCCCTGAGAAAGACTTCGCTGAGCACCTCCTCATCCCACGCACCAGGGGCCTCCTCAGCGGCTGGGCACGCAATGGCACTGACCTGGGCAACTCGCTGACCACGCGGCCTGTCACACTTGTGGAGGGGGAGGAGTGCGGGCAGGTCCTGAATGTGACTGTCACCACCAGGACCTACTGTGAGAGAAGCAGCGTGGCGGCCATGCACTGGATGGATGGAAGTGTGGTCACCAGAGAACACAGAGGCTCCTGGTTTCTCACGGGGGTCCTGGGCTCGCAGCCAGTAGGAGGGCAGGCTCACATGGTCCTTGTCACCAAGGTCTCCAGGTACTCACTCTGGTTTAAACAGATCATGAACTAA |
| ORF Protein Sequence | MAGCVPLLQGLVLVLALHRVEPSVFLPASKANDVLVRWKRAGSYLLEELFEGNLEKECYEEICVYEEAREVFENEVVTDEFWRRYKGGSPCISQPCLHNGSCQDSIWGYTCTCSPGYEGSNCELAKNECHPERTDGCQHFCLPGQESYTCSCAQGYRLGEDHKQCVPHDQCACGVLTSEKRAPDLQDLPWQVKLTNSEGKDFCGGVIIRENFVLTTAKCSLLHRNITVKTYFNRTSQDPLMIKITHVHVHMRYDADAGENDLSLLELEWPIQCPGAGLPVCTPEKDFAEHLLIPRTRGLLSGWARNGTDLGNSLTTRPVTLVEGEECGQVLNVTVTTRTYCERSSVAAMHWMDGSVVTREHRGSWFLTGVLGSQPVGGQAHMVLVTKVSRYSLWFKQIMN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1208-Ab | Anti-PROZ/ PZ functional antibody |
| Target Antigen | GM-Tg-g-SE1208-Ag | PROZ protein |
| ORF Viral Vector | pGMLV002109 | Human PROZ Lentivirus plasmid |
| ORF Viral Vector | vGMLV002109 | Human PROZ Lentivirus particle |
Target information
| Target ID | GM-SE1208 |
| Target Name | PROZ |
| Gene ID | 8858, 66901, 696982, 306608, 617946, 100067119 |
| Gene Symbol and Synonyms | 1300015B06Rik,PROZ,PZ |
| Uniprot Accession | P22891 |
| Uniprot Entry Name | PROZ_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000126231 |
| Target Classification | Not Available |
This gene encodes a liver vitamin K-dependent glycoprotein that is synthesized in the liver and secreted into the plasma. The encoded protein plays a role in regulating blood coagulation by complexing with protein Z-dependent protease inhibitor to directly inhibit activated factor X at the phospholipid surface. Deficiencies in this protein are associated with an increased risk of ischemic arterial diseases and fetal loss. Mutations in this gene are the cause of protein Z deficiency. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


