Order informatioin


Delivery impact due to the Coronavirus Outbreak

With the COVID-19 outbreak in the world, many flights have been cancelled. In order for the customer to receive the goods properly, we use the FedEx Customized Freight (FCF) of Fedex which demands a higher fee. If the delivery fee is more expensive in your area, we will contact you by mail.

Package Catalog No. Price(In USD) Qty (Quantity) Sum(In USD)
5ug GMV-V-2019nCoV-030 828
Shipping Cost: 760.00
Total:



Description

2019 nCoV related GeneORF3a
Species Host2019 nCoV
VectorpET21a
Reporternull
Antibiotic in Mammalian cellNone
Length828
PromoterT7
TagC-His
Coden Optimizedcoden optimized for E.coli
Gene Accession NumberLC528233.1
ApplicationE.coli expression, recombinant protein production
SequenceATGGATCTGTTTATGCGCATTTTTACCATTGGTACCGTGACCCTGAAACAGGGCGAAATTAAAGATGCAACCCCGAGCGATTTTGTTCGCGCAACCGCAACCATTCCGATTCAGGCATCACTGCCGTTTGGTTGGCTGATTGTGGGCGTTGCACTGCTGGCAGTGTTTCAGAGTGCAAGTAAAATTATTACCCTGAAAAAACGTTGGCAGCTGGCACTGAGTAAAGGCGTTCATTTTGTTTGTAATCTGCTGCTGCTGTTTGTGACCGTGTATAGTCATCTGCTGCTGGTTGCAGCAGGCCTGGAAGCACCGTTTCTGTATCTGTATGCACTGGTGTATTTTCTACAATCTATTAATTTTGTTCGCATTATTATGCGCCTGTGGCTGTGTTGGAAATGTCGCTCTAAAAATCCGCTGCTGTATGATGCAAATTATTTTCTGTGTTGGCATACCAATTGTTATGATTATTGTATTCCGTATAATAGCGTGACCTCTTCAATTGTGATTACCTCAGGCGATGGTACCACCTCTCCGATTAGCGAACATGATTATCAGATTGGCGGCTATACCGAAAAATGGGAAAGCGGTGTTAAAGATTGTGTGGTTCTGCATAGCTATTTTACCTCAGATTATTATCAGCTGTATAGTACCCAGTTAAGTACCGATACCGGCGTTGAACATGTGACCTTTTTTATTTATAATAAAATTGTGGATGAACCGGAAGAACATGTGCAGATTCATACCATTGATGGCTCTAGCGGCGTGGTTAATCCGGTGATGGAACCGATTTATGATGAACCGACCACCACCACCTCAGTGCCGCTG