Order information


Delivery impact due to the Coronavirus Outbreak

With the COVID-19 outbreak in the world, many flights have been cancelled. In order for the customer to receive the goods properly, we use the FedEx Customized Freight (FCF) of Fedex which demands a higher fee. If the delivery fee is more expensive in your area, we will contact you by mail.

Catalog No. Package Price(In USD) Qty (Quantity) Sum(In USD)
GMV-V-2019nCoV-050 1.0E+13VG 3998
GMV-V-2019nCoV-050 5.0E+13VG 11994
GMV-V-2019nCoV-050 1.0E+14VG 19990
GMV-V-2019nCoV-050 For larger scale Inquiry.
Shipping Cost: 760.00
Total:



Description

2019 nCoV related GeneSpike RBD
Species Host2019 nCoV
VectorPre-made AAV
ReporterZsgreen
Antibiotic in Mammalian cellnull
Length765
PromoterCMV
TagC-3FLAG
Codon OptimizedNo
Gene Accession NumberQHD43416.1
ApplicationAdenovirus-based 2019nCoV vaccine;
Adenovirus production;
Mammalian cells expression
Sequenceatgaatattacaaacttgtgcccttttggtgaagtttttaacgccaccagatttgcatctgtttatgcttggaacaggaagagaatcagcaactgtgttgctgattattctgtcctatataattccgcatcattttccacttttaagtgttatggagtgtctcctactaaattaaatgatctctgctttactaatgtctatgcagattcatttgtaattagaggtgatgaagtcagacaaatcgctccagggcaaactggaaagattgctgattataattataaattaccagatgattttacaggctgcgttatagcttggaattctaacaatcttgattctaaggttggtggtaattataattacctgtatagattgtttaggaagtctaatctcaaaccttttgagagagatatttcaactgaaatctatcaggccggtagcacaccttgtaatggtgttgaaggttttaattgttactttcctttacaatcatatggtttccaacccactaatggtgttggttaccaaccatacagagtagtagtactttcttttgaacttctacatgcaccagcaactgtttgtggacctaaaaagtctactaatttggttaaaaacaaatgtgtcaatttcaacttcaatggtttaacaggcacaggtgttcttactgagtctaacaaaaagtttctgcctttccaacaatttggcagagacattgctgacactactgatgctgtccgtgatccacagacacttgagtaa