Human TAC1/Hs.2563/NK2 ORF/cDNA clone-Adenovirus plasmid (BC018047)
Cat. No.: pGMAP000001
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TAC1/Hs.2563/NK2 adenoviral expression plasmid for TAC1 adenovirus packaging, TAC1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
TAC1/Hs.2563 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMAP000001 |
| Gene Name | TAC1 |
| Accession Number | BC018047 |
| Gene ID | 6863 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 390 bp |
| Gene Alias | Hs.2563,NK2,NPK |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGAAAATCCTCGTGGCCTTGGCAGTCTTTTTTCTTGTCTCCACTCAGCTGTTTGCAGAAGAAATAGGAGCCAATGATGATCTGAATTACTGGTCCGACTGGTACGACAGCGACCAGATCAAGGAGGAACTGCCGGAGCCCTTTGAGCATCTTCTGCAGAGAATCGCCCGGAGACCCAAGCCTCAGCAGTTCTTTGGATTAATGGGCAAACGGGATGCTGATTCCTCAATTGAAAAACAAGTGGCCCTGTTAAAGGCTCTTTATGGACATGGCCAGATCTCTCACAAAAGACATAAAACAGATTCCTTTGTTGGACTAATGGGCAAAAGAGCTTTAAATTCTGTGGCTTATGAAAGGAGTGCAATGCAGAATTATGAAAGAAGACGTTAA |
| ORF Protein Sequence | MKILVALAVFFLVSTQLFAEEIGANDDLNYWSDWYDSDQIKEELPEPFEHLLQRIARRPKPQQFFGLMGKRDADSSIEKQVALLKALYGHGQISHKRHKTDSFVGLMGKRALNSVAYERSAMQNYERRR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP2572-Ab | Anti-TKN1/ TAC1/ Hs.2563 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP2572-Ag | TAC1 VLP (virus-like particle) |
| ORF Viral Vector | pGMAP000001 | Human TAC1 Adenovirus plasmid |
| ORF Viral Vector | vGMAP000001 | Human TAC1 Adenovirus particle |
Target information
| Target ID | GM-MP2572 |
| Target Name | TAC1 |
| Gene ID | 6863, 21333, 697350, 24806, 101095481, 475239, 281512, 100052324 |
| Gene Symbol and Synonyms | 4930528L02Rik,beta-PPT-A,Hs.2563,NK-1,NK1,NK2,NKA,NKNA,NPK,PPT,PPT-A,Ppt5fl,PPTA,PPTA3,RATPPTA3,SP,TAC,TAC1,TAC2 |
| Uniprot Accession | P20366 |
| Uniprot Entry Name | TKN1_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Esophagus Cancer |
| Gene Ensembl | ENSG00000006128 |
| Target Classification | Not Available |
This gene encodes four products of the tachykinin peptide hormone family, substance P and neurokinin A, as well as the related peptides, neuropeptide K and neuropeptide gamma. These hormones are thought to function as neurotransmitters which interact with nerve receptors and smooth muscle cells. They are known to induce behavioral responses and function as vasodilators and secretagogues. Substance P is an antimicrobial peptide with antibacterial and antifungal properties. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


