Human TAC1/Hs.2563/ NK2 ORF/cDNA clone-Adenovirus plasmid (BC018047)

Pre-made Human TAC1/Hs.2563/ NK2 adenoviral expression plasmid for TAC1 adenovirus packaging, TAC1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to TAC1/Hs.2563 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000001 Human TAC1 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000001
Gene Name TAC1
Accession Number BC018047
Gene ID 6863
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 390 bp
Gene Alias Hs.2563, NK2, NPK
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAAATCCTCGTGGCCTTGGCAGTCTTTTTTCTTGTCTCCACTCAGCTGTTTGCAGAAGAAATAGGAGCCAATGATGATCTGAATTACTGGTCCGACTGGTACGACAGCGACCAGATCAAGGAGGAACTGCCGGAGCCCTTTGAGCATCTTCTGCAGAGAATCGCCCGGAGACCCAAGCCTCAGCAGTTCTTTGGATTAATGGGCAAACGGGATGCTGATTCCTCAATTGAAAAACAAGTGGCCCTGTTAAAGGCTCTTTATGGACATGGCCAGATCTCTCACAAAAGACATAAAACAGATTCCTTTGTTGGACTAATGGGCAAAAGAGCTTTAAATTCTGTGGCTTATGAAAGGAGTGCAATGCAGAATTATGAAAGAAGACGTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2572-Ab Anti-TKN1/ TAC1/ Hs.2563 monoclonal antibody
    Target Antigen GM-Tg-g-MP2572-Ag TAC1 VLP (virus-like particle)
    ORF Viral Vector pGMAP000001 Human TAC1 Adenovirus plasmid
    ORF Viral Vector vGMAP000001 Human TAC1 Adenovirus particle


    Target information

    Target ID GM-MP2572
    Target Name TAC1
    Gene ID 6863, 21333, 697350, 24806, 101095481, 475239, 281512, 100052324
    Gene Symbol and Synonyms 4930528L02Rik,beta-PPT-A,Hs.2563,NK-1,NK1,NK2,NKA,NKNA,NPK,PPT,PPT-A,Ppt5fl,PPTA,PPTA3,RATPPTA3,SP,TAC,TAC1,TAC2
    Uniprot Accession P20366
    Uniprot Entry Name TKN1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Esophagus Cancer
    Gene Ensembl ENSG00000006128
    Target Classification Not Available

    This gene encodes four products of the tachykinin peptide hormone family, substance P and neurokinin A, as well as the related peptides, neuropeptide K and neuropeptide gamma. These hormones are thought to function as neurotransmitters which interact with nerve receptors and smooth muscle cells. They are known to induce behavioral responses and function as vasodilators and secretagogues. Substance P is an antimicrobial peptide with antibacterial and antifungal properties. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.