Human WDR5/BIG-3 ORF/cDNA clone-Adenovirus plasmid (BC001635)

Cat. No.: pGMAP000024
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human WDR5/BIG-3 adenoviral expression plasmid for WDR5 adenovirus packaging, WDR5 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to WDR5/BIG-3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000024
Gene Name WDR5
Accession Number BC001635
Gene ID 11091
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1005 bp
Gene Alias BIG-3
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCGACGGAGGAGAAGAAGCCCGAGACCGAGGCCGCCAGAGCACAGCCAACCCCTTCGTCATCCGCCACTCAGAGCAAGCCTACACCTGTGAAGCCAAACTATGCTCTAAAGTTCACCCTTGCTGGCCACACCAAAGCAGTGTCCTCCGTGAAATTCAGCCCGAATGGAGAGTGGCTGGCAAGTTCATCTGCTGATAAACTTATTAAAATTTGGGGCGCGTATGATGGGAAATTTGAGAAAACCATATCTGGTCACAAGCTGGGAATATCCGATGTAGCCTGGTCGTCAGATTCTAACCTTCTTGTTTCTGCCTCAGATGACAAAACCTTGAAGATATGGGACGTGAGCTCGGGCAAGTGTCTGAAAACCCTGAAGGGACACAGTAATTATGTCTTTTGCTGCAACTTCAATCCCCAGTCCAACCTTATTGTCTCAGGATCCTTTGACGAAAGCGTGAGGATATGGGATGTGAAAACAGGGAAGTGCCTCAAGACTTTGCCAGCTCACTCGGATCCAGTCTCGGCCGTTCATTTTAATCGTGATGGATCCTTGATAGTTTCAAGTAGCTATGATGGTCTCTGTCGCATCTGGGACACCGCCTCGGGCCAGTGCCTGAAGACGCTCATCGATGACGACAACCCCCCCGTGTCTTTTGTGAAGTTCTCCCCGAACGGCAAATACATCCTGGCCGCCACGCTGGACAACACTCTGAAGCTCTGGGACTACAGCAAGGGGAAGTGCCTGAAGACGTACACTGGCCACAAGAATGAGAAATACTGCATATTTGCCAATTTCTCTGTTACTGGTGGGAAGTGGATTGTGTCTGGCTCAGAGGATAACCTTGTTTACATCTGGAACCTTCAGACGAAAGAGATTGTACAGAAACTACAAGGCCACACAGATGTCGTGATCTCAACAGCTTGTCACCCAACAGAAAACATCATCGCCTCTGCTGCGCTAGAAAATGACAAAACAATTAAACTGTGGAAGAGTGACTGCTAA
ORF Protein Sequence MATEEKKPETEAARAQPTPSSSATQSKPTPVKPNYALKFTLAGHTKAVSSVKFSPNGEWLASSSADKLIKIWGAYDGKFEKTISGHKLGISDVAWSSDSNLLVSASDDKTLKIWDVSSGKCLKTLKGHSNYVFCCNFNPQSNLIVSGSFDESVRIWDVKTGKCLKTLPAHSDPVSAVHFNRDGSLIVSSSYDGLCRIWDTASGQCLKTLIDDDNPPVSFVKFSPNGKYILAATLDNTLKLWDYSKGKCLKTYTGHKNEKYCIFANFSVTGGKWIVSGSEDNLVYIWNLQTKEIVQKLQGHTDVVISTACHPTENIIASAALENDKTIKLWKSDC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T77393-Ab Anti-WDR5 monoclonal antibody
    Target Antigen GM-Tg-g-T77393-Ag WDR5 protein
    ORF Viral Vector pGMAP000024 Human WDR5 Adenovirus plasmid
    ORF Viral Vector vGMAP000024 Human WDR5 Adenovirus particle


    Target information

    Target ID GM-T77393
    Target Name WDR5
    Gene ID 11091, 140858, 722123, 362093, 101082447, 608113, 100125836, 100069126
    Gene Symbol and Synonyms 2410008O07Rik,Big,BIG-3,BIG3,CFAP89,SWD3,WDR5
    Uniprot Accession P61964
    Uniprot Entry Name WDR5_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000196363
    Target Classification Not Available

    This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 7 WD repeats. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.