Human WDR5/BIG-3 ORF/cDNA clone-Adenovirus particle (BC001635)
Cat. No.: vGMAP000024
Pre-made Human WDR5/BIG-3 Adenovirus for WDR5 overexpression in-vitro and in-vivo. The WDR5 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified WDR5-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
WDR5/BIG-3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000024 | Human WDR5 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000024 |
| Gene Name | WDR5 |
| Accession Number | BC001635 |
| Gene ID | 11091 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1005 bp |
| Gene Alias | BIG-3 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGGCGACGGAGGAGAAGAAGCCCGAGACCGAGGCCGCCAGAGCACAGCCAACCCCTTCGTCATCCGCCACTCAGAGCAAGCCTACACCTGTGAAGCCAAACTATGCTCTAAAGTTCACCCTTGCTGGCCACACCAAAGCAGTGTCCTCCGTGAAATTCAGCCCGAATGGAGAGTGGCTGGCAAGTTCATCTGCTGATAAACTTATTAAAATTTGGGGCGCGTATGATGGGAAATTTGAGAAAACCATATCTGGTCACAAGCTGGGAATATCCGATGTAGCCTGGTCGTCAGATTCTAACCTTCTTGTTTCTGCCTCAGATGACAAAACCTTGAAGATATGGGACGTGAGCTCGGGCAAGTGTCTGAAAACCCTGAAGGGACACAGTAATTATGTCTTTTGCTGCAACTTCAATCCCCAGTCCAACCTTATTGTCTCAGGATCCTTTGACGAAAGCGTGAGGATATGGGATGTGAAAACAGGGAAGTGCCTCAAGACTTTGCCAGCTCACTCGGATCCAGTCTCGGCCGTTCATTTTAATCGTGATGGATCCTTGATAGTTTCAAGTAGCTATGATGGTCTCTGTCGCATCTGGGACACCGCCTCGGGCCAGTGCCTGAAGACGCTCATCGATGACGACAACCCCCCCGTGTCTTTTGTGAAGTTCTCCCCGAACGGCAAATACATCCTGGCCGCCACGCTGGACAACACTCTGAAGCTCTGGGACTACAGCAAGGGGAAGTGCCTGAAGACGTACACTGGCCACAAGAATGAGAAATACTGCATATTTGCCAATTTCTCTGTTACTGGTGGGAAGTGGATTGTGTCTGGCTCAGAGGATAACCTTGTTTACATCTGGAACCTTCAGACGAAAGAGATTGTACAGAAACTACAAGGCCACACAGATGTCGTGATCTCAACAGCTTGTCACCCAACAGAAAACATCATCGCCTCTGCTGCGCTAGAAAATGACAAAACAATTAAACTGTGGAAGAGTGACTGCTAA |
| ORF Protein Sequence | MATEEKKPETEAARAQPTPSSSATQSKPTPVKPNYALKFTLAGHTKAVSSVKFSPNGEWLASSSADKLIKIWGAYDGKFEKTISGHKLGISDVAWSSDSNLLVSASDDKTLKIWDVSSGKCLKTLKGHSNYVFCCNFNPQSNLIVSGSFDESVRIWDVKTGKCLKTLPAHSDPVSAVHFNRDGSLIVSSSYDGLCRIWDTASGQCLKTLIDDDNPPVSFVKFSPNGKYILAATLDNTLKLWDYSKGKCLKTYTGHKNEKYCIFANFSVTGGKWIVSGSEDNLVYIWNLQTKEIVQKLQGHTDVVISTACHPTENIIASAALENDKTIKLWKSDC |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T77393-Ab | Anti-WDR5 monoclonal antibody |
| Target Antigen | GM-Tg-g-T77393-Ag | WDR5 protein |
| ORF Viral Vector | pGMAP000024 | Human WDR5 Adenovirus plasmid |
| ORF Viral Vector | vGMAP000024 | Human WDR5 Adenovirus particle |
Target information
| Target ID | GM-T77393 |
| Target Name | WDR5 |
| Gene ID | 11091, 140858, 722123, 362093, 101082447, 608113, 100125836, 100069126 |
| Gene Symbol and Synonyms | 2410008O07Rik,Big,BIG-3,BIG3,CFAP89,SWD3,WDR5 |
| Uniprot Accession | P61964 |
| Uniprot Entry Name | WDR5_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000196363 |
| Target Classification | Not Available |
This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 7 WD repeats. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


