Human HLA-DRB1/HLA-DR1B ORF/cDNA clone-Adenovirus plasmid (BC007920)

Pre-made Human HLA-DRB1/HLA-DR1B adenoviral expression plasmid for HLA-DRB1 adenovirus packaging, HLA-DRB1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to HLA-DRB1/HLA-DR1B products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000059 Human HLA-DRB1 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000059
Gene Name HLA-DRB1
Accession Number BC007920
Gene ID 3123
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 801 bp
Gene Alias HLA-DR1B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTGTGTCTGAGGCTCCCTGGAGGCTCCTGCATGGCAGTTCTGACAGTGACACTGATGGTGCTGAGCTCCCCACTGGCTTTGGCTGGGGACACCAGACCACGTTTCTTGGAGTACTCTACGTCTGAGTGTCATTTCTTCAATGGGACGGAGCGGGTGCGGTTCCTGGACAGATACTTCCATAACCAGGAGGAGAACGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGACGGAGCTGGGGCGGCCTGATGCCGAGTACTGGAACAGCCAGAAGGACATCCTGGAAGACGAGCGGGCCGCGGTGGACACCTACTGCAGACACAACTACGGGGTTGGTGAGAGCTTCACAGTGCAGCGGCGAGTCCATCCTAAGGTGACTGTGTATCCTTCAAAGACCCAGCCCCTGCAGCACCACAACCTCCTGGTCTGTTCTGTGAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAATGGCCAGGAAGAGAAGACTGGGGTGGTGTCCACAGGCCTGATCCACAATGGAGACTGGACCTTCCAGACCCTGGTGATGCTGGAAACAGTTCCTCGGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCACCCAAGCGTGACAAGCCCTCTCACAGTGGAATGGAGAGCACGGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGGGCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTGTTCATCTACTTCAGGAATCAGAAAGGACACTCTGGACTTCAGCCAAGAGGATTCCTGAGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-736 Pre-Made Apolizumab Biosimilar, Whole Mab, Anti-HLA-DRB/HLA-DRB1 Antibody: Anti-DRB1/SS1 therapeutic antibody
    Target Antibody GM-Tg-g-T83611-Ab Anti-DRB1/ HLA-DRB1/ HLA-DR1B monoclonal antibody
    Target Antigen GM-Tg-g-T83611-Ag HLA-DRB1 VLP (virus-like particle)
    ORF Viral Vector pGMAP000059 Human HLA-DRB1 Adenovirus plasmid
    ORF Viral Vector pGMAP000274 Human HLA-DRB1 Adenovirus plasmid
    ORF Viral Vector vGMAP000059 Human HLA-DRB1 Adenovirus particle
    ORF Viral Vector vGMAP000274 Human HLA-DRB1 Adenovirus particle


    Target information

    Target ID GM-T83611
    Target Name HLA-DRB1
    Gene ID 3123
    Gene Symbol and Synonyms DRB1,HLA-DR1B,HLA-DRB,HLA-DRB1,SS1
    Uniprot Accession P01911
    Uniprot Entry Name DRB1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000196126
    Target Classification Tumor-associated antigen (TAA)

    HLA-DRB1 belongs to the HLA class II beta chain paralogs. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. The beta chain is approximately 26-28 kDa. It is encoded by 6 exons. Exon one encodes the leader peptide; exons 2 and 3 encode the two extracellular domains; exon 4 encodes the transmembrane domain; and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and some alleles have increased frequencies associated with certain diseases or conditions. For example, DRB1*1302 has been related to acute and chronic hepatitis B virus persistence. There are multiple pseudogenes of this gene. [provided by RefSeq, Jul 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.