Human TRPM8/LTRPC6/ MGC2849 ORF/cDNA clone-Adenovirus plasmid (BC001135.2)
Pre-made Human TRPM8/LTRPC6/ MGC2849 adenoviral expression plasmid for TRPM8 adenovirus packaging, TRPM8 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to TRPM8/LTRPC6 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000103 | Human TRPM8 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000103 |
Gene Name | TRPM8 |
Accession Number | BC001135.2 |
Gene ID | 79054 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 579 bp |
Gene Alias | LTRPC6, MGC2849, TRPP8 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAATCCTTCCTTCCTGTCCACACCATCGTGCTTATCAGGGAGAATGTGTGCAAGTGTGGCTATGCCCAGAGCCAGCACATGGAAGGCACCCAGATCAACCAAAGTGAGAAATGGAACTACAAGAAACACACCAAGGAATTTCCTACCGACGCCTTTGGGGATATTCAGTTTGAGACACTGGGGAAGAAAGGGAAGTATATACGTCTGTCCTGCGACACGGACGCGGAAATCCTTTACGAGCTGCTGACCCAGCACTGGCACCTGAAAACACCCAACCTGGTCATTTCTGTGACCGGGGGCGCCAAGAACTTCGCCCTGAAGCCGCGCATGCGCAAGATCTTCAGCCGGCTCATCTACATCGCGCAGTCCAAAGGTGCTTGGATTCTCACGGGAGGCACCCATTATGGCCTGATGAAGTACATCGGGGAGGTGGTGAGAGATAACACCATCAGCAGGAGTTCAGAGGAGAATATTGTGGCCATTGGCATAGCAGCTTGGGGCATGGTCTCCAACCGGGACACCCTCATCAGGAATTGCGATGCTGAGGTACCGGTGGGACAGGAGGAGGTCTGCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T41955-Ab | Anti-TRPM8/ LTRPC6/ LTrpC-6 monoclonal antibody |
Target Antigen | GM-Tg-g-T41955-Ag | TRPM8 VLP (virus-like particle) |
ORF Viral Vector | pGMAP000103 | Human TRPM8 Adenovirus plasmid |
ORF Viral Vector | vGMAP000103 | Human TRPM8 Adenovirus particle |
Target information
Target ID | GM-T41955 |
Target Name | TRPM8 |
Gene ID | 79054, 171382, 100429414, 171384, 101101245, 486170, 541151, 100057419 |
Gene Symbol and Synonyms | CMR1,LTrpC-6,LTRPC6,trp-p8,TRPM8,TRPP8 |
Uniprot Accession | Q7Z2W7 |
Uniprot Entry Name | TRPM8_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000144481 |
Target Classification | Not Available |
Predicted to enable ligand-gated calcium channel activity. Predicted to be involved in calcium ion transmembrane transport and positive regulation of cold-induced thermogenesis. Predicted to act upstream of or within several processes, including cellular calcium ion homeostasis; response to cold; and thermoception. Located in plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.