Human TRPM8/LTRPC6/ MGC2849 ORF/cDNA clone-Adenovirus plasmid (BC001135.2)

Pre-made Human TRPM8/LTRPC6/ MGC2849 adenoviral expression plasmid for TRPM8 adenovirus packaging, TRPM8 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to TRPM8/LTRPC6 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000103 Human TRPM8 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000103
Gene Name TRPM8
Accession Number BC001135.2
Gene ID 79054
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 579 bp
Gene Alias LTRPC6, MGC2849, TRPP8
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAATCCTTCCTTCCTGTCCACACCATCGTGCTTATCAGGGAGAATGTGTGCAAGTGTGGCTATGCCCAGAGCCAGCACATGGAAGGCACCCAGATCAACCAAAGTGAGAAATGGAACTACAAGAAACACACCAAGGAATTTCCTACCGACGCCTTTGGGGATATTCAGTTTGAGACACTGGGGAAGAAAGGGAAGTATATACGTCTGTCCTGCGACACGGACGCGGAAATCCTTTACGAGCTGCTGACCCAGCACTGGCACCTGAAAACACCCAACCTGGTCATTTCTGTGACCGGGGGCGCCAAGAACTTCGCCCTGAAGCCGCGCATGCGCAAGATCTTCAGCCGGCTCATCTACATCGCGCAGTCCAAAGGTGCTTGGATTCTCACGGGAGGCACCCATTATGGCCTGATGAAGTACATCGGGGAGGTGGTGAGAGATAACACCATCAGCAGGAGTTCAGAGGAGAATATTGTGGCCATTGGCATAGCAGCTTGGGGCATGGTCTCCAACCGGGACACCCTCATCAGGAATTGCGATGCTGAGGTACCGGTGGGACAGGAGGAGGTCTGCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T41955-Ab Anti-TRPM8/ LTRPC6/ LTrpC-6 monoclonal antibody
    Target Antigen GM-Tg-g-T41955-Ag TRPM8 VLP (virus-like particle)
    ORF Viral Vector pGMAP000103 Human TRPM8 Adenovirus plasmid
    ORF Viral Vector vGMAP000103 Human TRPM8 Adenovirus particle


    Target information

    Target ID GM-T41955
    Target Name TRPM8
    Gene ID 79054, 171382, 100429414, 171384, 101101245, 486170, 541151, 100057419
    Gene Symbol and Synonyms CMR1,LTrpC-6,LTRPC6,trp-p8,TRPM8,TRPP8
    Uniprot Accession Q7Z2W7
    Uniprot Entry Name TRPM8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000144481
    Target Classification Not Available

    Predicted to enable ligand-gated calcium channel activity. Predicted to be involved in calcium ion transmembrane transport and positive regulation of cold-induced thermogenesis. Predicted to act upstream of or within several processes, including cellular calcium ion homeostasis; response to cold; and thermoception. Located in plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.