Human TMEM140/FLJ11000 ORF/cDNA clone-Adenovirus plasmid (BC020942.1)

Cat. No.: pGMAP000209
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TMEM140/FLJ11000 adenoviral expression plasmid for TMEM140 adenovirus packaging, TMEM140 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to TMEM140/FLJ11000 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000209
Gene Name TMEM140
Accession Number BC020942.1
Gene ID 55281
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 558 bp
Gene Alias FLJ11000
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCCGGCCCAAGGCCTCAGTGGCGCGACGAGCTGCTGTTCATGAGCATCATAGTCCTCGTGATTGTGGTCATCTGCCTGATGTTATACGCTCTTCTCTGGGAGGCTGGCAACCTCACTGACCTGCCCAACCTGAGAATCGGCTTCTATAACTTCTGCCTGTGGAATGAGGACACCAGCACCCTACAGTGTCACCAGTTCCCTGAGCTGGAAGCCCTGGGGGTGCCTCGGGTTGGCCTGGGCCTGGCCAGGCTTGGCGTGTACGGGTCCCTGGTCCTCACCCTCTTTGCCCCCCAGCCTCTCCTCCTAGCCCAGTGCAACAGTGATGAGAGAGCGTGGCGGCTGGCAGTGGGCTTCCTGGCTGTGTCCTCTGTGCTGCTGGCCGGCGGCCTGGGCCTCTTCCTCTCCTATGTGTGGAAGTGGGTCAGGCTCTCCCTCCCGGGGCCTGGGTTTCTAGCTCTGGGCAGCGCCCAGGCCTTACTCATCCTCTTGCTTATAGCCATGGCTGTGTTCCCTCTGAGGGCTGAGAGGGCTGAGAGCAAGCTTGAGAGCTGCTAA
ORF Protein Sequence MAGPRPQWRDELLFMSIIVLVIVVICLMLYALLWEAGNLTDLPNLRIGFYNFCLWNEDTSTLQCHQFPELEALGVPRVGLGLARLGVYGSLVLTLFAPQPLLLAQCNSDERAWRLAVGFLAVSSVLLAGGLGLFLSYVWKWVRLSLPGPGFLALGSAQALLILLLIAMAVFPLRAERAESKLESC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1984-Ab Anti-TMEM140 monoclonal antibody
    Target Antigen GM-Tg-g-IP1984-Ag TMEM140 protein
    ORF Viral Vector pGMAP000209 Human TMEM140 Adenovirus plasmid
    ORF Viral Vector pGMAP000331 Human TMEM140 Adenovirus plasmid
    ORF Viral Vector vGMAP000209 Human TMEM140 Adenovirus particle
    ORF Viral Vector vGMAP000331 Human TMEM140 Adenovirus particle


    Target information

    Target ID GM-IP1984
    Target Name TMEM140
    Gene ID 55281, 68487, 707359, 362334, 101096303, 608116, 515475, 100065089
    Gene Symbol and Synonyms 1110007F12Rik,TMEM140
    Uniprot Accession Q9NV12
    Uniprot Entry Name TM140_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000146859
    Target Classification Not Available

    Predicted to be integral component of membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.