Human TMEM140/FLJ11000 ORF/cDNA clone-Adenovirus particle (BC020942.1)

Cat. No.: vGMAP000209

Pre-made Human TMEM140/FLJ11000 Adenovirus for TMEM140 overexpression in-vitro and in-vivo. The TMEM140 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TMEM140-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to TMEM140/FLJ11000 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000209 Human TMEM140 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000209
Gene Name TMEM140
Accession Number BC020942.1
Gene ID 55281
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 558 bp
Gene Alias FLJ11000
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCCGGCCCAAGGCCTCAGTGGCGCGACGAGCTGCTGTTCATGAGCATCATAGTCCTCGTGATTGTGGTCATCTGCCTGATGTTATACGCTCTTCTCTGGGAGGCTGGCAACCTCACTGACCTGCCCAACCTGAGAATCGGCTTCTATAACTTCTGCCTGTGGAATGAGGACACCAGCACCCTACAGTGTCACCAGTTCCCTGAGCTGGAAGCCCTGGGGGTGCCTCGGGTTGGCCTGGGCCTGGCCAGGCTTGGCGTGTACGGGTCCCTGGTCCTCACCCTCTTTGCCCCCCAGCCTCTCCTCCTAGCCCAGTGCAACAGTGATGAGAGAGCGTGGCGGCTGGCAGTGGGCTTCCTGGCTGTGTCCTCTGTGCTGCTGGCCGGCGGCCTGGGCCTCTTCCTCTCCTATGTGTGGAAGTGGGTCAGGCTCTCCCTCCCGGGGCCTGGGTTTCTAGCTCTGGGCAGCGCCCAGGCCTTACTCATCCTCTTGCTTATAGCCATGGCTGTGTTCCCTCTGAGGGCTGAGAGGGCTGAGAGCAAGCTTGAGAGCTGCTAA
ORF Protein Sequence MAGPRPQWRDELLFMSIIVLVIVVICLMLYALLWEAGNLTDLPNLRIGFYNFCLWNEDTSTLQCHQFPELEALGVPRVGLGLARLGVYGSLVLTLFAPQPLLLAQCNSDERAWRLAVGFLAVSSVLLAGGLGLFLSYVWKWVRLSLPGPGFLALGSAQALLILLLIAMAVFPLRAERAESKLESC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1984-Ab Anti-TMEM140 monoclonal antibody
    Target Antigen GM-Tg-g-IP1984-Ag TMEM140 protein
    ORF Viral Vector pGMAP000209 Human TMEM140 Adenovirus plasmid
    ORF Viral Vector pGMAP000331 Human TMEM140 Adenovirus plasmid
    ORF Viral Vector vGMAP000209 Human TMEM140 Adenovirus particle
    ORF Viral Vector vGMAP000331 Human TMEM140 Adenovirus particle


    Target information

    Target ID GM-IP1984
    Target Name TMEM140
    Gene ID 55281, 68487, 707359, 362334, 101096303, 608116, 515475, 100065089
    Gene Symbol and Synonyms 1110007F12Rik,TMEM140
    Uniprot Accession Q9NV12
    Uniprot Entry Name TM140_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000146859
    Target Classification Not Available

    Predicted to be integral component of membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.