Human CD4/CD4mut ORF/cDNA clone-Adenovirus plasmid (BC025782)

Pre-made Human CD4/CD4mut adenoviral expression plasmid for CD4 adenovirus packaging, CD4 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to CD4/CD4mut products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000215 Human CD4 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000215
Gene Name CD4
Accession Number BC025782
Gene ID 920
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1377 bp
Gene Alias CD4mut
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGCGCTCCTCCCAGCAGCCACTCAGGGAAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGGAACTGACCTGTACAGCTTCCCAGAAGAAGAGCATACAATTCCACTGGAAAAACTCCAACCAGATAAAGATTCTGGGAAATCAGGGCTCCTTCTTAACTAAAGGTCCATCCAAGCTGAATGATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAGGAAACTTTCCCCTGATCATCAAGAATCTTAAGATAGAAGACTCAGATACTTACATCTGTGAAGTGGAGGACCAGAAGGAGGAGGTGCAATTGCTAGTGTTCGGATTGACTGCCAACTCTGACACCCACCTGCTTCAGGGGCAGAGCCTGACCCTGACCTTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAATGTAGGAGTCCAAGGGGTAAAAACATACAGGGGGGGAAGACCCTCTCCGTGTCTCAGCTGGAGCTCCAGGATAGTGGCACCTGGACATGCACTGTCTTGCAGAACCAGAAGAAGGTGGAGTTCAAAATAGACATCGTGGTGCTAGCTTTCCAGAAGGCCTCCAGCATAGTCTATAAGAAAGAGGGGGAACAGGTGGAGTTCTCCTTCCCACTCGCCTTTACAGTTGAAAAGCTGACGGGCAGTGGCGAGCTGTGGTGGCAGGCGGAGAGGGCTTCCTCCTCCAAGTCTTGGATCACCTTTGACCTGAAGAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACCCTAAGCTCCAGATGGGCAAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTCAGTATGCTGGCTCTGGAAACCTCACCCTGGCCCTTGAAGCGAAAACAGGAAAGTTGCATCAGGAAGTGAACCTGGTGGTGATGAGAGCCACTCAGCTCCAGAAAAATTTGACCTGTGAGGTGTGGGGACCCACCTCCCCTAAGCTGATGCTGAGCTTGAAACTGGAGAACAAGGAGGCAAAGGTCTCGAAGCGGGAGAAGGCGGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCAGTGTCTGCTGAGTGACTCGGGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACATGGTCCACCCCGGTGCAGCCAATGGCCCTGATTGTGCTGGGGGGCGTCGCCGGCCTCCTGCTTTTCATTGGGCTAGGCATCTTCTTCTGTGTCAGGTGCCGGCACCGAAGGCGCCAAGCAGAGCGGATGTCTCAGATCAAGAGACTCCTCAGTGAGAAGAAGACCTGCCAGTGCCCTCACCGGTTTCAGAAGACATGTAGCCCCATTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-640 Pre-Made Zanolimumab biosimilar, Whole mAb, Anti-CD4 Antibody: Anti-IMD79/OKT4D therapeutic antibody
    Biosimilar GMP-Bios-INN-965 Pre-Made Priliximab Biosimilar, Whole Mab, Anti-Cd4 Antibody: Anti-IMD79/OKT4D therapeutic antibody
    Biosimilar GMP-Bios-INN-782 Pre-Made Clenoliximab Biosimilar, Whole Mab, Anti-Cd4 Antibody: Anti-IMD79/OKT4D therapeutic antibody
    Biosimilar GMP-Bios-ab-257 Pre-Made Ibalizumab biosimilar, Whole mAb, Anti-CD4 Antibody: Anti-IMD79/OKT4D therapeutic antibody
    Biosimilar GMP-Bios-INN-881 Pre-Made Keliximab Biosimilar, Whole Mab, Anti-Cd4 Antibody: Anti-IMD79/OKT4D therapeutic antibody
    Biosimilar GMP-Bios-ab-594 Pre-Made Tregalizumab biosimilar, Whole mAb, Anti-CD4 Antibody: Anti-IMD79/OKT4D therapeutic antibody
    Biosimilar GMP-Bios-INN-773 Pre-Made Cedelizumab Biosimilar, Whole Mab, Anti-Cd4 Antibody: Anti-IMD79/OKT4D therapeutic antibody
    Target Antibody GM-Tg-g-T10191-Ab Anti-CD4/ CD4mut monoclonal antibody
    Target Antigen GM-Tg-g-T10191-Ag CD4 VLP (virus-like particle)
    ORF Viral Vector pGMLP004095 Human CD4 Lentivirus plasmid
    ORF Viral Vector pGMAP000215 Human CD4 Adenovirus plasmid
    ORF Viral Vector vGMLP004095 Human CD4 Lentivirus particle
    ORF Viral Vector vGMAP000215 Human CD4 Adenovirus particle


    Target information

    Target ID GM-T10191
    Target Name CD4
    Gene ID 920, 12504, 713807, 24932, 493775, 403931, 407098, 100052502
    Gene Symbol and Synonyms CD4,CD4mut,IMD79,L3T4,Leu-3,Ly-4,OKT4D,p55,T4,W3/25
    Uniprot Accession P01730
    Uniprot Entry Name CD4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000010610
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes the CD4 membrane glycoprotein of T lymphocytes. The CD4 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class II MHC molecules. The CD4 antigen is also a primary receptor for entry of the human immunodeficiency virus through interactions with the HIV Env gp120 subunit. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, granulocytes, as well as in various regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, May 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.