Human GAPDH/G3PD ORF/cDNA clone-Adenovirus plasmid (BC001601)
Cat. No.: pGMAP000245
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human GAPDH/G3PD adenoviral expression plasmid for GAPDH adenovirus packaging, GAPDH adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
GAPDH/G3PD products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMAP000245 |
| Gene Name | GAPDH |
| Accession Number | BC001601 |
| Gene ID | 2597 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 1008 bp |
| Gene Alias | G3PD |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCTCCGGGAAACTGTGGCGTGATGGCCGCGGGGCTCTCCAGAACATCATCCCTGCCTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAACGGGAAGCTCACTGGCATGGCCTTCCGTGTCCCCACTGCCAACGTGTCAGTGGTGGACCTGACCTGCCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTGGGCTACACTGAGCACCAGGTGGTCTCCTCTGACTTCAACAGCGACACCCACTCCTCCACCTTTGACGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAA |
| ORF Protein Sequence | MGKVKVGVNGFGRIGRLVTRAAFNSGKVDIVAINDPFIDLNYMVYMFQYDSTHGKFHGTVKAENGKLVINGNPITIFQERDPSKIKWGDAGAEYVVESTGVFTTMEKAGAHLQGGAKRVIISAPSADAPMFVMGVNHEKYDNSLKIISNASCTTNCLAPLAKVIHDNFGIVEGLMTTVHAITATQKTVDGPSGKLWRDGRGALQNIIPASTGAAKAVGKVIPELNGKLTGMAFRVPTANVSVVDLTCRLEKPAKYDDIKKVVKQASEGPLKGILGYTEHQVVSSDFNSDTHSSTFDAGAGIALNDHFVKLISWYDNEFGYSNRVVDLMAHMASKE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T39321-Ab | Anti-G3P/ GAPDH/ G3PD monoclonal antibody |
| Target Antigen | GM-Tg-g-T39321-Ag | GAPDH VLP (virus-like particle) |
| ORF Viral Vector | pGMLP001944 | Human GAPDH Lentivirus plasmid |
| ORF Viral Vector | pGMAP000245 | Human GAPDH Adenovirus plasmid |
| ORF Viral Vector | vGMLP001944 | Human GAPDH Lentivirus particle |
| ORF Viral Vector | vGMAP000245 | Human GAPDH Adenovirus particle |
Target information
| Target ID | GM-T39321 |
| Target Name | GAPDH |
| Gene ID | 2597, 14433, 574353, 24383, 493876, 403755, 281181, 100033897 |
| Gene Symbol and Synonyms | BARS-38,G3PD,G3PDH,GAPD,GAPDH,HEL-S-162eP |
| Uniprot Accession | P04406 |
| Uniprot Entry Name | G3P_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000111640 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The product of this gene catalyzes an important energy-yielding step in carbohydrate metabolism, the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD). The encoded protein has additionally been identified to have uracil DNA glycosylase activity in the nucleus. Also, this protein contains a peptide that has antimicrobial activity against E. coli, P. aeruginosa, and C. albicans. Studies of a similar protein in mouse have assigned a variety of additional functions including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Many pseudogenes similar to this locus are present in the human genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


