Human LIN28A/CSDD1/ LIN-28 ORF/cDNA clone-Adenovirus plasmid (BC028566)
Pre-made Human LIN28A/CSDD1/ LIN-28 adenoviral expression plasmid for LIN28A adenovirus packaging, LIN28A adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to Lin-28A/LIN28A/CSDD1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000263 | Human LIN28A Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000263 |
Gene Name | LIN28A |
Accession Number | BC028566 |
Gene ID | 79727 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 630 bp |
Gene Alias | CSDD1, LIN-28, LIN28A, ZCCHC1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGCTCCGTGTCCAACCAGCAGTTTGCAGGTGGCTGCGCCAAGGCGGCAGAAGAGGCGCCCGAGGAGGCGCCGGAGGACGCGGCCCGGGCGGCGGACGAGCCTCAGCTGCTGCACGGTGCGGGCATCTGTAAGTGGTTCAACGTGCGCATGGGGTTCGGCTTCCTGTCCATGACCGCCCGCGCCGGGGTCGCGCTCGACCCCCCAGTGGATGTCTTTGTGCACCAGAGTAAGCTGCACATGGAAGGGTTCCGGAGCTTGAAGGAGGGTGAGGCAGTGGAGTTCACCTTTAAGAAGTCAGCCAAGGGTCTGGAATCCATCCGTGTCACCGGACCTGGTGGAGTATTCTGTATTGGGAGTGAGAGGCGGCCAAAAGGAAAGAGCATGCAGAAGCGCAGATCAAAAGGAGACAGGTGCTACAACTGTGGAGGTCTAGATCATCATGCCAAGGAATGCAAGCTGCCACCCCAGCCCAAGAAGTGCCACTTCTGCCAGAGCATCAGCCATATGGTAGCCTCATGTCCGCTGAAGGCCCAGCAGGGCCCTAGTGCACAGGGAAAGCCAACCTACTTTCGAGAGGAAGAAGAAGAAATCCACAGCCCTACCCTGCTCCCGGAGGCACAGAATTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T49593-Ab | Anti-Lin-28A monoclonal antibody |
Target Antigen | GM-Tg-g-T49593-Ag | Lin-28A/LIN28A protein |
ORF Viral Vector | pGMLV000061 | Human LIN28A Lentivirus plasmid |
ORF Viral Vector | pGMPC000178 | Human LIN28A Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000263 | Human LIN28A Adenovirus plasmid |
ORF Viral Vector | vGMLV000061 | Human LIN28A Lentivirus particle |
ORF Viral Vector | vGMAP000263 | Human LIN28A Adenovirus particle |
Target information
Target ID | GM-T49593 |
Target Name | Lin-28A |
Gene ID | 79727, 83557, 719865, 500562, 100379627, 102151926, 614997, 100071098 |
Gene Symbol and Synonyms | CSDD1,Gm10299,LIN-28,lin-28A,LIN28,LIN28A,RGD1566408,Tex17,ZCCHC1 |
Uniprot Accession | Q9H9Z2 |
Uniprot Entry Name | LN28A_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000131914 |
Target Classification | Not Available |
This gene encodes a LIN-28 family RNA-binding protein that acts as a posttranscriptional regulator of genes involved in developmental timing and self-renewal in embryonic stem cells. The encoded protein functions through direct interaction with target mRNAs and by disrupting the maturation of certain miRNAs involved in embryonic development. This protein prevents the terminal processing of the LET7 family of microRNAs which are major regulators of cellular growth and differentiation. Aberrant expression of this gene is associated with cancer progression in multiple tissues. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.