Human LIN28A/CSDD1/ LIN-28 ORF/cDNA clone-Adenovirus plasmid (BC028566)

Pre-made Human LIN28A/CSDD1/ LIN-28 adenoviral expression plasmid for LIN28A adenovirus packaging, LIN28A adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to Lin-28A/LIN28A/CSDD1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000263 Human LIN28A Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000263
Gene Name LIN28A
Accession Number BC028566
Gene ID 79727
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 630 bp
Gene Alias CSDD1, LIN-28, LIN28A, ZCCHC1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCTCCGTGTCCAACCAGCAGTTTGCAGGTGGCTGCGCCAAGGCGGCAGAAGAGGCGCCCGAGGAGGCGCCGGAGGACGCGGCCCGGGCGGCGGACGAGCCTCAGCTGCTGCACGGTGCGGGCATCTGTAAGTGGTTCAACGTGCGCATGGGGTTCGGCTTCCTGTCCATGACCGCCCGCGCCGGGGTCGCGCTCGACCCCCCAGTGGATGTCTTTGTGCACCAGAGTAAGCTGCACATGGAAGGGTTCCGGAGCTTGAAGGAGGGTGAGGCAGTGGAGTTCACCTTTAAGAAGTCAGCCAAGGGTCTGGAATCCATCCGTGTCACCGGACCTGGTGGAGTATTCTGTATTGGGAGTGAGAGGCGGCCAAAAGGAAAGAGCATGCAGAAGCGCAGATCAAAAGGAGACAGGTGCTACAACTGTGGAGGTCTAGATCATCATGCCAAGGAATGCAAGCTGCCACCCCAGCCCAAGAAGTGCCACTTCTGCCAGAGCATCAGCCATATGGTAGCCTCATGTCCGCTGAAGGCCCAGCAGGGCCCTAGTGCACAGGGAAAGCCAACCTACTTTCGAGAGGAAGAAGAAGAAATCCACAGCCCTACCCTGCTCCCGGAGGCACAGAATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T49593-Ab Anti-Lin-28A monoclonal antibody
    Target Antigen GM-Tg-g-T49593-Ag Lin-28A/LIN28A protein
    ORF Viral Vector pGMLV000061 Human LIN28A Lentivirus plasmid
    ORF Viral Vector pGMPC000178 Human LIN28A Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000263 Human LIN28A Adenovirus plasmid
    ORF Viral Vector vGMLV000061 Human LIN28A Lentivirus particle
    ORF Viral Vector vGMAP000263 Human LIN28A Adenovirus particle


    Target information

    Target ID GM-T49593
    Target Name Lin-28A
    Gene ID 79727, 83557, 719865, 500562, 100379627, 102151926, 614997, 100071098
    Gene Symbol and Synonyms CSDD1,Gm10299,LIN-28,lin-28A,LIN28,LIN28A,RGD1566408,Tex17,ZCCHC1
    Uniprot Accession Q9H9Z2
    Uniprot Entry Name LN28A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000131914
    Target Classification Not Available

    This gene encodes a LIN-28 family RNA-binding protein that acts as a posttranscriptional regulator of genes involved in developmental timing and self-renewal in embryonic stem cells. The encoded protein functions through direct interaction with target mRNAs and by disrupting the maturation of certain miRNAs involved in embryonic development. This protein prevents the terminal processing of the LET7 family of microRNAs which are major regulators of cellular growth and differentiation. Aberrant expression of this gene is associated with cancer progression in multiple tissues. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.