Human DNASE1L1/DNAS1L1/XIB ORF/cDNA clone-Adenovirus plasmid (BC001561)

Cat. No.: pGMAP000390
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DNASE1L1/DNAS1L1/XIB adenoviral expression plasmid for DNASE1L1 adenovirus packaging, DNASE1L1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to DNASE1L1/DNAS1L1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000390
Gene Name DNASE1L1
Accession Number BC001561
Gene ID 1774
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 909 bp
Gene Alias DNAS1L1,XIB
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCACTACCCAACTGCACTCCTCTTCCTCATCCTGGCCAATGGGGCCCAGGCCTTTCGCATCTGCGCCTTCAATGCCCAGCGGCTGACACTGGCCAAGGTGGCCAGGGAGCAGGTGATGGACACCTTAGTTCGGATACTGGCTCGCTGTGACATCATGGTGCTGCAGGAGGTGGTGGACTCTTCCGGCAGCGCCATCCCCCTCCTGCTTCGAGAACTCAATCGATTTGATGGCTCTGGGCCCTACAGCACCCTGAGCAGCCCCCAGCTGGGGCGCAGCACCTACATGGAGACGTATGTGTACTTCTATCGGTCACACAAAACACAGGTCCTGAGTTCCTACGTGTACAACGATGAGGATGACGTCTTTGCCCGGGAGCCATTTGTGGCCCAGTTCTCTTTGCCCAGCAATGTCCTTCCCAGCCTGGTGTTGGTCCCGCTGCACACCACTCCTAAGGCCGTAGAGAAGGAGCTGAACGCCCTCTACGATGTGTTTCTGGAGGTCTCCCAGCACTGGCAGAGCAAGGACGTGATCCTGCTTGGGGACTTCAATGCTGACTGCGCTTCACTGACCAAAAAGCGCCTGGACAAGCTGGAGCTGCGGACTGAGCCAGGCTTCCACTGGGTGATTGCCGATGGGGAGGACACCACAGTGCGGGCCAGCACCCACTGCACCTATGACCGCGTCGTGCTGCACGGGGAGCGCTGCCGGAGTCTGCTGCACACTGCGGCTGCCTTTGACTTCCCCACGAGCTTCCAGCTCACCGAGGAGGAGGCCCTCAACATCAGTGACCACTACCCCGTGGAGGTGGAGCTGAAGCTGAGCCAGGCACACAGCGTCCAGCCTCTCAGCCTCACTGTTCTGTTGCTGCTATCACTCCTGTCCCCTCAGCTGTGCCCTGCTGCCTGA
ORF Protein Sequence MHYPTALLFLILANGAQAFRICAFNAQRLTLAKVAREQVMDTLVRILARCDIMVLQEVVDSSGSAIPLLLRELNRFDGSGPYSTLSSPQLGRSTYMETYVYFYRSHKTQVLSSYVYNDEDDVFAREPFVAQFSLPSNVLPSLVLVPLHTTPKAVEKELNALYDVFLEVSQHWQSKDVILLGDFNADCASLTKKRLDKLELRTEPGFHWVIADGEDTTVRASTHCTYDRVVLHGERCRSLLHTAAAFDFPTSFQLTEEEALNISDHYPVEVELKLSQAHSVQPLSLTVLLLLSLLSPQLCPAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0160-Ab Anti-DNSL1/ DNASE1L1/ DNAS1L1 functional antibody
    Target Antigen GM-Tg-g-SE0160-Ag DNASE1L1 protein
    ORF Viral Vector pGMAP000390 Human DNASE1L1 Adenovirus plasmid
    ORF Viral Vector vGMAP000390 Human DNASE1L1 Adenovirus particle


    Target information

    Target ID GM-SE0160
    Target Name DNASE1L1
    Gene ID 1774, 69537, 100425571, 363522, 101091518, 119868550, 515176, 100059443
    Gene Symbol and Synonyms 2310005K03Rik,DNAS1L1,DNASE1L1,Dnase1ll,DNASEX,DNL1L,Dnl1ll,G4.8,XIB
    Uniprot Accession P49184
    Uniprot Entry Name DNSL1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000013563
    Target Classification Not Available

    This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.