Human DNASE1L1/DNAS1L1/XIB ORF/cDNA clone-Adenovirus particle (BC001561)

Cat. No.: vGMAP000390

Pre-made Human DNASE1L1/DNAS1L1/XIB Adenovirus for DNASE1L1 overexpression in-vitro and in-vivo. The DNASE1L1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified DNASE1L1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to DNASE1L1/DNAS1L1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000390 Human DNASE1L1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000390
Gene Name DNASE1L1
Accession Number BC001561
Gene ID 1774
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 909 bp
Gene Alias DNAS1L1,XIB
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCACTACCCAACTGCACTCCTCTTCCTCATCCTGGCCAATGGGGCCCAGGCCTTTCGCATCTGCGCCTTCAATGCCCAGCGGCTGACACTGGCCAAGGTGGCCAGGGAGCAGGTGATGGACACCTTAGTTCGGATACTGGCTCGCTGTGACATCATGGTGCTGCAGGAGGTGGTGGACTCTTCCGGCAGCGCCATCCCCCTCCTGCTTCGAGAACTCAATCGATTTGATGGCTCTGGGCCCTACAGCACCCTGAGCAGCCCCCAGCTGGGGCGCAGCACCTACATGGAGACGTATGTGTACTTCTATCGGTCACACAAAACACAGGTCCTGAGTTCCTACGTGTACAACGATGAGGATGACGTCTTTGCCCGGGAGCCATTTGTGGCCCAGTTCTCTTTGCCCAGCAATGTCCTTCCCAGCCTGGTGTTGGTCCCGCTGCACACCACTCCTAAGGCCGTAGAGAAGGAGCTGAACGCCCTCTACGATGTGTTTCTGGAGGTCTCCCAGCACTGGCAGAGCAAGGACGTGATCCTGCTTGGGGACTTCAATGCTGACTGCGCTTCACTGACCAAAAAGCGCCTGGACAAGCTGGAGCTGCGGACTGAGCCAGGCTTCCACTGGGTGATTGCCGATGGGGAGGACACCACAGTGCGGGCCAGCACCCACTGCACCTATGACCGCGTCGTGCTGCACGGGGAGCGCTGCCGGAGTCTGCTGCACACTGCGGCTGCCTTTGACTTCCCCACGAGCTTCCAGCTCACCGAGGAGGAGGCCCTCAACATCAGTGACCACTACCCCGTGGAGGTGGAGCTGAAGCTGAGCCAGGCACACAGCGTCCAGCCTCTCAGCCTCACTGTTCTGTTGCTGCTATCACTCCTGTCCCCTCAGCTGTGCCCTGCTGCCTGA
ORF Protein Sequence MHYPTALLFLILANGAQAFRICAFNAQRLTLAKVAREQVMDTLVRILARCDIMVLQEVVDSSGSAIPLLLRELNRFDGSGPYSTLSSPQLGRSTYMETYVYFYRSHKTQVLSSYVYNDEDDVFAREPFVAQFSLPSNVLPSLVLVPLHTTPKAVEKELNALYDVFLEVSQHWQSKDVILLGDFNADCASLTKKRLDKLELRTEPGFHWVIADGEDTTVRASTHCTYDRVVLHGERCRSLLHTAAAFDFPTSFQLTEEEALNISDHYPVEVELKLSQAHSVQPLSLTVLLLLSLLSPQLCPAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0160-Ab Anti-DNSL1/ DNASE1L1/ DNAS1L1 functional antibody
    Target Antigen GM-Tg-g-SE0160-Ag DNASE1L1 protein
    ORF Viral Vector pGMAP000390 Human DNASE1L1 Adenovirus plasmid
    ORF Viral Vector vGMAP000390 Human DNASE1L1 Adenovirus particle


    Target information

    Target ID GM-SE0160
    Target Name DNASE1L1
    Gene ID 1774, 69537, 100425571, 363522, 101091518, 119868550, 515176, 100059443
    Gene Symbol and Synonyms 2310005K03Rik,DNAS1L1,DNASE1L1,Dnase1ll,DNASEX,DNL1L,Dnl1ll,G4.8,XIB
    Uniprot Accession P49184
    Uniprot Entry Name DNSL1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000013563
    Target Classification Not Available

    This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.