Human NTF4/NT-4/5/NT4 ORF/cDNA clone-Adenovirus plasmid (BC012421)

Cat. No.: pGMAP000409
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NTF4/NT-4/5/NT4 adenoviral expression plasmid for NTF4 adenovirus packaging, NTF4 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to NTF4/NT-4/5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000409
Gene Name NTF4
Accession Number BC012421
Gene ID 4909
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 633 bp
Gene Alias NT-4/5,NT4,NT5
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCTCCCTCTCCCCTCATGCTCCCTCCCCATCCTCCTCCTTTTCCTCCTCCCCAGTGTGCCAATTGAGTCCCAACCCCCACCCTCAACATTGCCCCCTTTTCTGGCCCCTGAGTGGGACCTTCTCTCCCCCCGAGTAGTCCTGTCTAGGGGTGCCCCTGCTGGGCCCCCTCTGCTCTTCCTGCTGGAGGCTGGGGCCTTTCGGGAGTCAGCAGGTGCCCCGGCCAACCGCAGCCGGCGTGGGGTGAGCGAAACTGCACCAGCGAGTCGTCGGGGTGAGCTGGCTGTGTGCGATGCAGTCAGTGGCTGGGTGACAGACCGCCGGACCGCTGTGGACTTGCGTGGGCGCGAGGTGGAGGTGTTGGGCGAGGTGCCTGCAGCTGGCGGCAGTCCCCTCCGCCAGTACTTCTTTGAAACCCGCTGCAAGGCTGATAACGCTGAGGAAGGTGGCCCGGGGGCAGGTGGAGGGGGCTGCCGGGGAGTGGACAGGAGGCACTGGGTATCTGAGTGCAAGGCCAAGCAGTCCTATGTGCGGGCATTGACCGCTGATGCCCAGGGCCGTGTGGGCTGGCGATGGATTCGAATTGACACTGCCTGCGTCTGCACACTCCTCAGCCGGACTGGCCGGGCCTGA
ORF Protein Sequence MLPLPSCSLPILLLFLLPSVPIESQPPPSTLPPFLAPEWDLLSPRVVLSRGAPAGPPLLFLLEAGAFRESAGAPANRSRRGVSETAPASRRGELAVCDAVSGWVTDRRTAVDLRGREVEVLGEVPAAGGSPLRQYFFETRCKADNAEEGGPGAGGGGCRGVDRRHWVSECKAKQSYVRALTADAQGRVGWRWIRIDTACVCTLLSRTGRA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T00902-Ab Anti-NTF4/ GLC10/ GLC1O functional antibody
    Target Antigen GM-Tg-g-T00902-Ag NTF4 protein
    ORF Viral Vector pGMAP000409 Human NTF4 Adenovirus plasmid
    ORF Viral Vector vGMAP000409 Human NTF4 Adenovirus particle


    Target information

    Target ID GM-T00902
    Target Name NTF4
    Gene ID 4909, 78405, 25730, 101100428, 611987, 506660, 100054859
    Gene Symbol and Synonyms 2900040K06Rik,GLC10,GLC1O,NT-4,NT-4/5,NT-5,NT4,NT4/5,NT4P,NT5,Ntf-5,NTF4,NTF5
    Uniprot Accession P34130
    Uniprot Entry Name NTF4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000225950
    Target Classification Not Available

    This gene is a member of a family of neurotrophic factors, neurotrophins, that control survival and differentiation of mammalian neurons. The expression of this gene is ubiquitous and less influenced by environmental signals. While knock-outs of other neurotrophins including nerve growth factor, brain-derived neurotrophic factor, and neurotrophin 3  prove lethal during early postnatal development, NTF5-deficient mice only show minor cellular deficits and develop normally to adulthood. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.