Human NTF4/NT-4/5/NT4 ORF/cDNA clone-Adenovirus particle (BC012421)

Cat. No.: vGMAP000409

Pre-made Human NTF4/NT-4/5/NT4 Adenovirus for NTF4 overexpression in-vitro and in-vivo. The NTF4 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified NTF4-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to NTF4/NT-4/5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000409 Human NTF4 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000409
Gene Name NTF4
Accession Number BC012421
Gene ID 4909
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 633 bp
Gene Alias NT-4/5,NT4,NT5
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCTCCCTCTCCCCTCATGCTCCCTCCCCATCCTCCTCCTTTTCCTCCTCCCCAGTGTGCCAATTGAGTCCCAACCCCCACCCTCAACATTGCCCCCTTTTCTGGCCCCTGAGTGGGACCTTCTCTCCCCCCGAGTAGTCCTGTCTAGGGGTGCCCCTGCTGGGCCCCCTCTGCTCTTCCTGCTGGAGGCTGGGGCCTTTCGGGAGTCAGCAGGTGCCCCGGCCAACCGCAGCCGGCGTGGGGTGAGCGAAACTGCACCAGCGAGTCGTCGGGGTGAGCTGGCTGTGTGCGATGCAGTCAGTGGCTGGGTGACAGACCGCCGGACCGCTGTGGACTTGCGTGGGCGCGAGGTGGAGGTGTTGGGCGAGGTGCCTGCAGCTGGCGGCAGTCCCCTCCGCCAGTACTTCTTTGAAACCCGCTGCAAGGCTGATAACGCTGAGGAAGGTGGCCCGGGGGCAGGTGGAGGGGGCTGCCGGGGAGTGGACAGGAGGCACTGGGTATCTGAGTGCAAGGCCAAGCAGTCCTATGTGCGGGCATTGACCGCTGATGCCCAGGGCCGTGTGGGCTGGCGATGGATTCGAATTGACACTGCCTGCGTCTGCACACTCCTCAGCCGGACTGGCCGGGCCTGA
ORF Protein Sequence MLPLPSCSLPILLLFLLPSVPIESQPPPSTLPPFLAPEWDLLSPRVVLSRGAPAGPPLLFLLEAGAFRESAGAPANRSRRGVSETAPASRRGELAVCDAVSGWVTDRRTAVDLRGREVEVLGEVPAAGGSPLRQYFFETRCKADNAEEGGPGAGGGGCRGVDRRHWVSECKAKQSYVRALTADAQGRVGWRWIRIDTACVCTLLSRTGRA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T00902-Ab Anti-NTF4/ GLC10/ GLC1O functional antibody
    Target Antigen GM-Tg-g-T00902-Ag NTF4 protein
    ORF Viral Vector pGMAP000409 Human NTF4 Adenovirus plasmid
    ORF Viral Vector vGMAP000409 Human NTF4 Adenovirus particle


    Target information

    Target ID GM-T00902
    Target Name NTF4
    Gene ID 4909, 78405, 25730, 101100428, 611987, 506660, 100054859
    Gene Symbol and Synonyms 2900040K06Rik,GLC10,GLC1O,NT-4,NT-4/5,NT-5,NT4,NT4/5,NT4P,NT5,Ntf-5,NTF4,NTF5
    Uniprot Accession P34130
    Uniprot Entry Name NTF4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000225950
    Target Classification Not Available

    This gene is a member of a family of neurotrophic factors, neurotrophins, that control survival and differentiation of mammalian neurons. The expression of this gene is ubiquitous and less influenced by environmental signals. While knock-outs of other neurotrophins including nerve growth factor, brain-derived neurotrophic factor, and neurotrophin 3  prove lethal during early postnatal development, NTF5-deficient mice only show minor cellular deficits and develop normally to adulthood. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.