Human BMP7/OP-1 ORF/cDNA clone-Adenovirus plasmid (BC008584)

Pre-made Human BMP7/OP-1 adenoviral expression plasmid for BMP7 adenovirus packaging, BMP7 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to BMP7/OP-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000439 Human BMP7 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000439
Gene Name BMP7
Accession Number BC008584
Gene ID 655
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1296 bp
Gene Alias OP-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCACGTGCGCTCACTGCGAGCTGCGGCGCCGCACAGCTTCGTGGCGCTCTGGGCACCCCTGTTCCTGCTGCGCTCCGCCCTGGCCGACTTCAGCCTGGACAACGAGGTGCACTCGAGCTTCATCCACCGGCGCCTCCGCAGCCAGGAGCGGCGGGAGATGCAGCGCGAGATCCTCTCCATTTTGGGCTTGCCCCACCGCCCGCGCCCGCACCTCCAGGGCAAGCACAACTCGGCACCCATGTTCATGCTGGACCTGTACAACGCCATGGCGGTGGAGGAGGGCGGCGGGCCCGGCGGCCAGGGCTTCTCCTACCCCTACAAGGCCGTCTTCAGTACCCAGGGCCCCCCTCTGGCCAGCCTGCAAGATAGCCATTTCCTCACCGACGCCGACATGGTCATGAGCTTCGTCAACCTCGTGGAACATGACAAGGAATTCTTCCACCCACGCTACCACCATCGAGAGTTCCGGTTTGATCTTTCCAAGATCCCAGAAGGGGAAGCTGTCACGGCAGCCGAATTCCGGATCTACAAGGACTACATCCGGGAACGCTTCGACAATGAGACGTTCCGGATCAGCGTTTATCAGGTGCTCCAGGAGCACTTGGGCAGGGAATCGGATCTCTTCCTGCTCGACAGCCGTACCCTCTGGGCCTCGGAGGAGGGCTGGCTGGTGTTTGACATCACAGCCACCAGCAACCACTGGGTGGTCAATCCGCGGCACAACCTGGGCCTGCAGCTCTCGGTGGAGACGCTGGATGGGCAGAGCATCAACCCCAAGTTGGCGGGCCTGATTGGGCGGCACGGGCCCCAGAACAAGCAGCCCTTCATGGTGGCTTTCTTCAAGGCCACGGAGGTCCACTTCCGCAGCATCCGGTCCACGGGGAGCAAACAGCGCAGCCAGAACCGCTCCAAGACGCCCAAGAACCAGGAAGCCCTGCGGATGGCCAACGTGGCAGAGAACAGCAGCAGCGACCAGAGGCAGGCCTGTAAGAAGCACGAGCTGTATGTCAGCTTCCGAGACCTGGGCTGGCAGGACTGGATCATCGCGCCTGAAGGCTACGCCGCCTACTACTGTGAGGGGGAGTGTGCCTTCCCTCTGAACTCCTACATGAACGCCACCAACCACGCCATCGTGCAGACGCTGGTCCACTTCATCAACCCGGAAACGGTGCCCAAGCCCTGCTGTGCGCCCACGCAGCTCAATGCCATCTCCGTCCTCTACTTCGATGACAGCTCCAACGTCATCCTGAAGAAATACAGAAACATGGTGGTCCGGGCCTGTGGCTGCCACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T50289-Ab Anti-BMP7/ OP-1 functional antibody
    Target Antigen GM-Tg-g-T50289-Ag BMP7 protein
    Cytokine cks-Tg-g-GM-T50289 bone morphogenetic protein 7 (BMP7) protein & antibody
    ORF Viral Vector pGMLV000318 Human BMP7 Lentivirus plasmid
    ORF Viral Vector pGMLV000319 Human BMP7 Lentivirus plasmid
    ORF Viral Vector pGMAAV000461 Human BMP7 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000439 Human BMP7 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-070 Human BMP7 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-210 Human BMP7 Adenovirus plasmid
    ORF Viral Vector vGMLV000318 Human BMP7 Lentivirus particle
    ORF Viral Vector vGMLV000319 Human BMP7 Lentivirus particle
    ORF Viral Vector vGMAAV000461 Human BMP7 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000439 Human BMP7 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-070 Human BMP7 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-210 Human BMP7 Adenovirus particle


    Target information

    Target ID GM-T50289
    Target Name BMP7
    Gene ID 655, 12162, 696948, 85272, 101094168, 477270, 540595, 100050299
    Gene Symbol and Synonyms BMP-7,BMP7,OP-1,OP1
    Uniprot Accession P18075
    Uniprot Entry Name BMP7_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000101144
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer, which plays a role in bone, kidney and brown adipose tissue development. Additionally, this protein induces ectopic bone formation and may promote fracture healing in human patients. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.