Human VTI1B/VTI1/VTI1L ORF/cDNA clone-Adenovirus plasmid (BC003142)
Cat. No.: pGMAP000454
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human VTI1B/VTI1/VTI1L adenoviral expression plasmid for VTI1B adenovirus packaging, VTI1B adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
VTI1B/VTI1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMAP000454 |
| Gene Name | VTI1B |
| Accession Number | BC003142 |
| Gene ID | 10490 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 699 bp |
| Gene Alias | VTI1,VTI1L,VTI2 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCTCCTCCGCCGCCTCCTCGGAGCATTTCGAGAAGCTGCACGAGATCTTCCGCGGCCTCCATGAAGACCTACAAGGGGTGCCCGAGCGGCTGCTGGGGACGGCGGGGACCGAAGAAAAGAAGAAATTGATCAGGGATTTTGATGAAAAGCAACAGGAAGCAAATGAAACGCTGGCAGAGATGGAGGAGGAGCTACGTTATGCACCCCTGTCTTTCCGAAACCCCATGATGTCTAAGCTTCGAAACTACCGGAAGGACCTTGCTAAACTCCATCGGGAGGTGAGAAGCACACCTTTGACAGCCACACCTGGAGGCCGAGGAGACATGAAATATGGCATATATGCTGTAGAGAATGAGCATATGAATCGGCTACAGTCTCAAAGGGCAATGCTTCTGCAGGGCACTGAAAGCCTGAACCGGGCCACCCAAAGTATTGAACGTTCTCATCGGATTGCCACAGAGACTGACCAGATTGGCTCAGAAATCATAGAAGAGCTGGGGGAACAACGAGACCAGTTAGAACGTACCAAGAGTAGACTGGTAAACACAAGTGAAAACTTGAGCAAAAGTCGGAAGATTCTCCGTTCAATGTCCAGAAAAGTGACAACCAACAAGCTGCTGCTTTCCATTATCATCTTACTGGAGCTCGCCATCCTGGGAGGCCTGGTTTACTACAAATTCTTTCGCAGCCATTGA |
| ORF Protein Sequence | MASSAASSEHFEKLHEIFRGLHEDLQGVPERLLGTAGTEEKKKLIRDFDEKQQEANETLAEMEEELRYAPLSFRNPMMSKLRNYRKDLAKLHREVRSTPLTATPGGRGDMKYGIYAVENEHMNRLQSQRAMLLQGTESLNRATQSIERSHRIATETDQIGSEIIEELGEQRDQLERTKSRLVNTSENLSKSRKILRSMSRKVTTNKLLLSIIILLELAILGGLVYYKFFRSH |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE0547-Ab | Anti-VTI1B/ VTI1/ VTI1-LIKE functional antibody |
| Target Antigen | GM-Tg-g-SE0547-Ag | VTI1B protein |
| ORF Viral Vector | pGMAP000228 | Human VTI1B Adenovirus plasmid |
| ORF Viral Vector | pGMAP000454 | Human VTI1B Adenovirus plasmid |
| ORF Viral Vector | vGMAP000228 | Human VTI1B Adenovirus particle |
| ORF Viral Vector | vGMAP000454 | Human VTI1B Adenovirus particle |
Target information
| Target ID | GM-SE0547 |
| Target Name | VTI1B |
| Gene ID | 10490, 53612, 711113, 100359512, 101092692, 480365, 780809, 100052972 |
| Gene Symbol and Synonyms | GES30,MVti1b,RGD1560475,SNARE,v-SNARE,VTI1,VTI1-LIKE,vti1-rp1,VTI1B,VTI1L,Vti1l1,VTI2 |
| Uniprot Accession | Q9UEU0 |
| Uniprot Entry Name | VTI1B_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000100568 |
| Target Classification | Not Available |
Enables SNARE binding activity and chloride channel inhibitor activity. Involved in regulation of protein localization to plasma membrane. Located in several cellular components, including endosome membrane; lysosomal membrane; and perinuclear region of cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


