Human VTI1B/VTI1/VTI1L ORF/cDNA clone-Adenovirus particle (BC003142)

Cat. No.: vGMAP000228

Pre-made Human VTI1B/VTI1/VTI1L Adenovirus for VTI1B overexpression in-vitro and in-vivo. The VTI1B adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified VTI1B-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to VTI1B/VTI1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000228 Human VTI1B Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000228
Gene Name VTI1B
Accession Number BC003142
Gene ID 10490
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 699 bp
Gene Alias VTI1,VTI1L,VTI2
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCCTCCTCCGCCGCCTCCTCGGAGCATTTCGAGAAGCTGCACGAGATCTTCCGCGGCCTCCATGAAGACCTACAAGGGGTGCCCGAGCGGCTGCTGGGGACGGCGGGGACCGAAGAAAAGAAGAAATTGATCAGGGATTTTGATGAAAAGCAACAGGAAGCAAATGAAACGCTGGCAGAGATGGAGGAGGAGCTACGTTATGCACCCCTGTCTTTCCGAAACCCCATGATGTCTAAGCTTCGAAACTACCGGAAGGACCTTGCTAAACTCCATCGGGAGGTGAGAAGCACACCTTTGACAGCCACACCTGGAGGCCGAGGAGACATGAAATATGGCATATATGCTGTAGAGAATGAGCATATGAATCGGCTACAGTCTCAAAGGGCAATGCTTCTGCAGGGCACTGAAAGCCTGAACCGGGCCACCCAAAGTATTGAACGTTCTCATCGGATTGCCACAGAGACTGACCAGATTGGCTCAGAAATCATAGAAGAGCTGGGGGAACAACGAGACCAGTTAGAACGTACCAAGAGTAGACTGGTAAACACAAGTGAAAACTTGAGCAAAAGTCGGAAGATTCTCCGTTCAATGTCCAGAAAAGTGACAACCAACAAGCTGCTGCTTTCCATTATCATCTTACTGGAGCTCGCCATCCTGGGAGGCCTGGTTTACTACAAATTCTTTCGCAGCCATTGA
ORF Protein Sequence MASSAASSEHFEKLHEIFRGLHEDLQGVPERLLGTAGTEEKKKLIRDFDEKQQEANETLAEMEEELRYAPLSFRNPMMSKLRNYRKDLAKLHREVRSTPLTATPGGRGDMKYGIYAVENEHMNRLQSQRAMLLQGTESLNRATQSIERSHRIATETDQIGSEIIEELGEQRDQLERTKSRLVNTSENLSKSRKILRSMSRKVTTNKLLLSIIILLELAILGGLVYYKFFRSH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0547-Ab Anti-VTI1B/ VTI1/ VTI1-LIKE functional antibody
    Target Antigen GM-Tg-g-SE0547-Ag VTI1B protein
    ORF Viral Vector pGMAP000228 Human VTI1B Adenovirus plasmid
    ORF Viral Vector pGMAP000454 Human VTI1B Adenovirus plasmid
    ORF Viral Vector vGMAP000228 Human VTI1B Adenovirus particle
    ORF Viral Vector vGMAP000454 Human VTI1B Adenovirus particle


    Target information

    Target ID GM-SE0547
    Target Name VTI1B
    Gene ID 10490, 53612, 711113, 100359512, 101092692, 480365, 780809, 100052972
    Gene Symbol and Synonyms GES30,MVti1b,RGD1560475,SNARE,v-SNARE,VTI1,VTI1-LIKE,vti1-rp1,VTI1B,VTI1L,Vti1l1,VTI2
    Uniprot Accession Q9UEU0
    Uniprot Entry Name VTI1B_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000100568
    Target Classification Not Available

    Enables SNARE binding activity and chloride channel inhibitor activity. Involved in regulation of protein localization to plasma membrane. Located in several cellular components, including endosome membrane; lysosomal membrane; and perinuclear region of cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.