Human IFNB1/IFB/IFF ORF/cDNA clone-Adenovirus plasmid (BC096150)
Cat. No.: pGMAP000549
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IFNB1/IFB/IFF adenoviral expression plasmid for IFNB1 adenovirus packaging, IFNB1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
IFNB1/IFB products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMAP000549 |
| Gene Name | IFNB1 |
| Accession Number | BC096150 |
| Gene ID | 3456 |
| Species | Human |
| Product Type | Adenovirus plasmid (overexpression) |
| Insert Length | 564 bp |
| Gene Alias | IFB,IFF,MGC96956 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGACCAACAAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCCACTACAGCTCTTTCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAATTTTCAGTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGCCTCAAGGACAGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGTTCCAGAAGGAGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGCTATTTTCAGACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAACCTCCTGGCTAATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAAAAACTGGAGAAAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACCTGAAAAGATATTATGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAGTCACTGTGCCTGGACCATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTCATTAACAGACTTACAGGTTACCTCCGAAACTGA |
| ORF Protein Sequence | MTNKCLLQIALLLCFSTTALSMSYNLLGFLQRSSNFQCQKLLWQLNGRLEYCLKDRMNFDIPEEIKQLQQFQKEDAALTIYEMLQNIFAIFRQDSSSTGWNETIVENLLANVYHQINHLKTVLEEKLEKEDFTRGKLMSSLHLKRYYGRILHYLKAKEYSHCAWTIVRVEILRNFYFINRLTGYLRN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T02808-Ab | Anti-IFNB/ IFNB1/ IFB functional antibody |
| Target Antigen | GM-Tg-g-T02808-Ag | IFNB1 protein |
| Cytokine | cks-Tg-g-GM-T02808 | interferon, beta 1, fibroblast (IFNB1) protein & antibody |
| ORF Viral Vector | pGMLP000557 | Human IFNB1 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000549 | Human IFNB1 Adenovirus plasmid |
| ORF Viral Vector | vGMLP000557 | Human IFNB1 Lentivirus particle |
| ORF Viral Vector | vGMAP000549 | Human IFNB1 Adenovirus particle |
Target information
| Target ID | GM-T02808 |
| Target Name | IFNB1 |
| Gene ID | 3456, 15977, 711414, 24481, 493849, 481558 |
| Gene Symbol and Synonyms | If1da1,IFB,IFF,IFN-beta,IFNB,IFNB1 |
| Uniprot Accession | P01574 |
| Uniprot Entry Name | IFNB_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000171855 |
| Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a cytokine that belongs to the interferon family of signaling proteins, which are released as part of the innate immune response to pathogens. The protein encoded by this gene belongs to the type I class of interferons, which are important for defense against viral infections. In addition, type I interferons are involved in cell differentiation and anti-tumor defenses. Following secretion in response to a pathogen, type I interferons bind a homologous receptor complex and induce transcription of genes such as those encoding inflammatory cytokines and chemokines. Overactivation of type I interferon secretion is linked to autoimmune diseases. Mice deficient for this gene display several phenotypes including defects in B cell maturation and increased susceptibility to viral infection. [provided by RefSeq, Sep 2015]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


