Human CCND1/U21B31 ORF/cDNA clone-Adenovirus plasmid (BC025302)
Pre-made Human CCND1/U21B31 adenoviral expression plasmid for CCND1 adenovirus packaging, CCND1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to CCND1/U21B31 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000562 | Human CCND1 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000562 |
Gene Name | CCND1 |
Accession Number | BC025302 |
Gene ID | 595 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 888 bp |
Gene Alias | U21B31 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCCGATGCCAACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGAGGAGACCTGCGCGCCCTCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGTCCTGCCGTCCATGCGGAAGATCGTCGCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTGGCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAGCTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGACCCGGACTGCCTCCGGGCCTGCCAGGAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGCCAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAGGTGGACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T12355-Ab | Anti-CCND1 monoclonal antibody |
Target Antigen | GM-Tg-g-T12355-Ag | CCND1 protein |
ORF Viral Vector | pGMLV000042 | Human CCND1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000670 | Human CCND1 Lentivirus plasmid |
ORF Viral Vector | pGMPC000006 | Human CCND1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000351 | Human CCND1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000562 | Human CCND1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000042 | Human CCND1 Lentivirus particle |
ORF Viral Vector | vGMLV000670 | Human CCND1 Lentivirus particle |
ORF Viral Vector | vGMAP000562 | Human CCND1 Adenovirus particle |
ORF Viral Vector | pGMLV002266 | Human CCND1 Lentivirus plasmid |
Target information
Target ID | GM-T12355 |
Target Name | CCND1 |
Gene ID | 595, 12443, 574320, 58919, 100037407, 449028, 524530, 102149114 |
Gene Symbol and Synonyms | bcl-1,BCL1,CCND1,cD1,CycD1,Cyl-1,D11S287E,PRAD1,U21B31 |
Uniprot Accession | P24385 |
Uniprot Entry Name | CCND1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Breast Cancer, Head and neck squamous cell carcinoma (HNSCC), tumor, Cancer, Breast cancer |
Gene Ensembl | ENSG00000110092 |
Target Classification | Not Available |
The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance throughout the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with tumor suppressor protein Rb and the expression of this gene is regulated positively by Rb. Mutations, amplification and overexpression of this gene, which alters cell cycle progression, are observed frequently in a variety of human cancers. [provided by RefSeq, Dec 2019]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.