Human CCND1/U21B31 ORF/cDNA clone-Adenovirus plasmid (BC025302)

Pre-made Human CCND1/U21B31 adenoviral expression plasmid for CCND1 adenovirus packaging, CCND1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to CCND1/U21B31 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000562 Human CCND1 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000562
Gene Name CCND1
Accession Number BC025302
Gene ID 595
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 888 bp
Gene Alias U21B31
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCCGATGCCAACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGAGGAGACCTGCGCGCCCTCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGTCCTGCCGTCCATGCGGAAGATCGTCGCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTGGCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAGCTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGACCCGGACTGCCTCCGGGCCTGCCAGGAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGCCAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAGGTGGACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T12355-Ab Anti-CCND1 monoclonal antibody
    Target Antigen GM-Tg-g-T12355-Ag CCND1 protein
    ORF Viral Vector pGMLV000042 Human CCND1 Lentivirus plasmid
    ORF Viral Vector pGMLV000670 Human CCND1 Lentivirus plasmid
    ORF Viral Vector pGMPC000006 Human CCND1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000351 Human CCND1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000562 Human CCND1 Adenovirus plasmid
    ORF Viral Vector vGMLV000042 Human CCND1 Lentivirus particle
    ORF Viral Vector vGMLV000670 Human CCND1 Lentivirus particle
    ORF Viral Vector vGMAP000562 Human CCND1 Adenovirus particle
    ORF Viral Vector pGMLV002266 Human CCND1 Lentivirus plasmid


    Target information

    Target ID GM-T12355
    Target Name CCND1
    Gene ID 595, 12443, 574320, 58919, 100037407, 449028, 524530, 102149114
    Gene Symbol and Synonyms bcl-1,BCL1,CCND1,cD1,CycD1,Cyl-1,D11S287E,PRAD1,U21B31
    Uniprot Accession P24385
    Uniprot Entry Name CCND1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Breast Cancer, Head and neck squamous cell carcinoma (HNSCC), tumor, Cancer, Breast cancer
    Gene Ensembl ENSG00000110092
    Target Classification Not Available

    The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance throughout the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with tumor suppressor protein Rb and the expression of this gene is regulated positively by Rb. Mutations, amplification and overexpression of this gene, which alters cell cycle progression, are observed frequently in a variety of human cancers. [provided by RefSeq, Dec 2019]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.