Human RUNX1/AML1/AML1-EVI-1 ORF/cDNA clone-Lentivirus plasmid (NM_001754.4)

Cat. No.: pGMLV000314
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RUNX1/AML1/AML1-EVI-1 Lentiviral expression plasmid for RUNX1 lentivirus packaging, RUNX1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to RUNX1/AML1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $704.04
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000314
Gene Name RUNX1
Accession Number NM_001754.4
Gene ID 861
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1443 bp
Gene Alias AML1,AML1-EVI-1,AMLCR1,CBF2alpha,CBFA2,EVI-1,PEBP2aB,PEBP2alpha
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag AM (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTTCAGACAGCATATTTGAGTCATTTCCTTCGTACCCACAGTGCTTCATGAGAGAATGCATACTTGGAATGAATCCTTCTAGAGACGTCCACGATGCCAGCACGAGCCGCCGCTTCACGCCGCCTTCCACCGCGCTGAGCCCAGGCAAGATGAGCGAGGCGTTGCCGCTGGGCGCCCCGGACGCCGGCGCTGCCCTGGCCGGCAAGCTGAGGAGCGGCGACCGCAGCATGGTGGAGGTGCTGGCCGACCACCCGGGCGAGCTGGTGCGCACCGACAGCCCCAACTTCCTCTGCTCCGTGCTGCCTACGCACTGGCGCTGCAACAAGACCCTGCCCATCGCTTTCAAGGTGGTGGCCCTAGGGGATGTTCCAGATGGCACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCAGCTGCGGCGCACAGCCATGAGGGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGATACAAGGCAGATCCAACCATCCCCACCGTGGTCCTACGATCAGTCCTACCAATACCTGGGATCCATTGCCTCTCCTTCTGTGCACCCAGCAACGCCCATTTCACCTGGACGTGCCAGCGGCATGACAACCCTCTCTGCAGAACTTTCCAGTCGACTCTCAACGGCACCCGACCTGACAGCGTTCAGCGACCCGCGCCAGTTCCCCGCGCTGCCCTCCATCTCCGACCCCCGCATGCACTATCCAGGCGCCTTCACCTACTCCCCGACGCCGGTCACCTCGGGCATCGGCATCGGCATGTCGGCCATGGGCTCGGCCACGCGCTACCACACCTACCTGCCGCCGCCCTACCCCGGCTCGTCGCAAGCGCAGGGAGGCCCGTTCCAAGCCAGCTCGCCCTCCTACCACCTGTACTACGGCGCCTCGGCCGGCTCCTACCAGTTCTCCATGGTGGGCGGCGAGCGCTCGCCGCCGCGCATCCTGCCGCCCTGCACCAACGCCTCCACCGGCTCCGCGCTGCTCAACCCCAGCCTCCCGAACCAGAGCGACGTGGTGGAGGCCGAGGGCAGCCACAGCAACTCCCCCACCAACATGGCGCCCTCCGCGCGCCTGGAGGAGGCCGTGTGGAGGCCCTACTGA
ORF Protein Sequence MASDSIFESFPSYPQCFMRECILGMNPSRDVHDASTSRRFTPPSTALSPGKMSEALPLGAPDAGAALAGKLRSGDRSMVEVLADHPGELVRTDSPNFLCSVLPTHWRCNKTLPIAFKVVALGDVPDGTLVTVMAGNDENYSAELRNATAAMKNQVARFNDLRFVGRSGRGKSFTLTITVFTNPPQVATYHRAIKITVDGPREPRRHRQKLDDQTKPGSLSFSERLSELEQLRRTAMRVSPHHPAPTPNPRASLNHSTAFNPQPQSQMQDTRQIQPSPPWSYDQSYQYLGSIASPSVHPATPISPGRASGMTTLSAELSSRLSTAPDLTAFSDPRQFPALPSISDPRMHYPGAFTYSPTPVTSGIGIGMSAMGSATRYHTYLPPPYPGSSQAQGGPFQASSPSYHLYYGASAGSYQFSMVGGERSPPRILPPCTNASTGSALLNPSLPNQSDVVEAEGSHSNSPTNMAPSARLEEAVWRPY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T43711-Ab Anti-RUNX1 monoclonal antibody
    Target Antigen GM-Tg-g-T43711-Ag RUNX1 protein
    ORF Viral Vector pGMLV000314 Human RUNX1 Lentivirus plasmid
    ORF Viral Vector pGMLV000843 Human RUNX1 Lentivirus plasmid
    ORF Viral Vector pGMPC001443 Human RUNX1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001636 Human RUNX1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000314 Human RUNX1 Lentivirus particle
    ORF Viral Vector vGMLV000843 Human RUNX1 Lentivirus particle


    Target information

    Target ID GM-T43711
    Target Name RUNX1
    Gene ID 861, 12394, 696749, 50662, 101084898, 487746, 529631, 100051950
    Gene Symbol and Synonyms AML1,AML1-EVI-1,AMLCR1,CBF-alpha-2,CBF2alpha,CBFA2,EVI-1,PEA2-alpha,PEBP2-alpha,Pebp2a2,PEBP2aB,PEBP2alpha,Pebpa2b,RUNX1
    Uniprot Accession Q01196
    Uniprot Entry Name RUNX1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000159216
    Target Classification Tumor-associated antigen (TAA)

    Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.