Human RUNX1/AML1/AML1-EVI-1 ORF/cDNA clone-Lentivirus plasmid (NM_001754.4)
Cat. No.: pGMLV000314
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human RUNX1/AML1/AML1-EVI-1 Lentiviral expression plasmid for RUNX1 lentivirus packaging, RUNX1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
RUNX1/AML1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV000314 |
Gene Name | RUNX1 |
Accession Number | NM_001754.4 |
Gene ID | 861 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1443 bp |
Gene Alias | AML1,AML1-EVI-1,AMLCR1,CBF2alpha,CBFA2,EVI-1,PEBP2aB,PEBP2alpha |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | AM (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCTTCAGACAGCATATTTGAGTCATTTCCTTCGTACCCACAGTGCTTCATGAGAGAATGCATACTTGGAATGAATCCTTCTAGAGACGTCCACGATGCCAGCACGAGCCGCCGCTTCACGCCGCCTTCCACCGCGCTGAGCCCAGGCAAGATGAGCGAGGCGTTGCCGCTGGGCGCCCCGGACGCCGGCGCTGCCCTGGCCGGCAAGCTGAGGAGCGGCGACCGCAGCATGGTGGAGGTGCTGGCCGACCACCCGGGCGAGCTGGTGCGCACCGACAGCCCCAACTTCCTCTGCTCCGTGCTGCCTACGCACTGGCGCTGCAACAAGACCCTGCCCATCGCTTTCAAGGTGGTGGCCCTAGGGGATGTTCCAGATGGCACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAACTGGAGCAGCTGCGGCGCACAGCCATGAGGGTCAGCCCACACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATGCAGGATACAAGGCAGATCCAACCATCCCCACCGTGGTCCTACGATCAGTCCTACCAATACCTGGGATCCATTGCCTCTCCTTCTGTGCACCCAGCAACGCCCATTTCACCTGGACGTGCCAGCGGCATGACAACCCTCTCTGCAGAACTTTCCAGTCGACTCTCAACGGCACCCGACCTGACAGCGTTCAGCGACCCGCGCCAGTTCCCCGCGCTGCCCTCCATCTCCGACCCCCGCATGCACTATCCAGGCGCCTTCACCTACTCCCCGACGCCGGTCACCTCGGGCATCGGCATCGGCATGTCGGCCATGGGCTCGGCCACGCGCTACCACACCTACCTGCCGCCGCCCTACCCCGGCTCGTCGCAAGCGCAGGGAGGCCCGTTCCAAGCCAGCTCGCCCTCCTACCACCTGTACTACGGCGCCTCGGCCGGCTCCTACCAGTTCTCCATGGTGGGCGGCGAGCGCTCGCCGCCGCGCATCCTGCCGCCCTGCACCAACGCCTCCACCGGCTCCGCGCTGCTCAACCCCAGCCTCCCGAACCAGAGCGACGTGGTGGAGGCCGAGGGCAGCCACAGCAACTCCCCCACCAACATGGCGCCCTCCGCGCGCCTGGAGGAGGCCGTGTGGAGGCCCTACTGA |
ORF Protein Sequence | MASDSIFESFPSYPQCFMRECILGMNPSRDVHDASTSRRFTPPSTALSPGKMSEALPLGAPDAGAALAGKLRSGDRSMVEVLADHPGELVRTDSPNFLCSVLPTHWRCNKTLPIAFKVVALGDVPDGTLVTVMAGNDENYSAELRNATAAMKNQVARFNDLRFVGRSGRGKSFTLTITVFTNPPQVATYHRAIKITVDGPREPRRHRQKLDDQTKPGSLSFSERLSELEQLRRTAMRVSPHHPAPTPNPRASLNHSTAFNPQPQSQMQDTRQIQPSPPWSYDQSYQYLGSIASPSVHPATPISPGRASGMTTLSAELSSRLSTAPDLTAFSDPRQFPALPSISDPRMHYPGAFTYSPTPVTSGIGIGMSAMGSATRYHTYLPPPYPGSSQAQGGPFQASSPSYHLYYGASAGSYQFSMVGGERSPPRILPPCTNASTGSALLNPSLPNQSDVVEAEGSHSNSPTNMAPSARLEEAVWRPY |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T43711-Ab | Anti-RUNX1 monoclonal antibody |
Target Antigen | GM-Tg-g-T43711-Ag | RUNX1 protein |
ORF Viral Vector | pGMLV000314 | Human RUNX1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000843 | Human RUNX1 Lentivirus plasmid |
ORF Viral Vector | pGMPC001443 | Human RUNX1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC001636 | Human RUNX1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000314 | Human RUNX1 Lentivirus particle |
ORF Viral Vector | vGMLV000843 | Human RUNX1 Lentivirus particle |
Target information
Target ID | GM-T43711 |
Target Name | RUNX1 |
Gene ID | 861, 12394, 696749, 50662, 101084898, 487746, 529631, 100051950 |
Gene Symbol and Synonyms | AML1,AML1-EVI-1,AMLCR1,CBF-alpha-2,CBF2alpha,CBFA2,EVI-1,PEA2-alpha,PEBP2-alpha,Pebp2a2,PEBP2aB,PEBP2alpha,Pebpa2b,RUNX1 |
Uniprot Accession | Q01196 |
Uniprot Entry Name | RUNX1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000159216 |
Target Classification | Tumor-associated antigen (TAA) |
Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.