Human AKT2/HIHGHH/PKBB ORF/cDNA clone-Lentivirus plasmid (NM_001243027.2)
Cat. No.: pGMLV000359
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human AKT2/HIHGHH/PKBB Lentiviral expression plasmid for AKT2 lentivirus packaging, AKT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
AKT2/HIHGHH products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV000359 |
| Gene Name | AKT2 |
| Accession Number | NM_001243027.2 |
| Gene ID | 208 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1260 bp |
| Gene Alias | HIHGHH,PKBB,PKBBETA,PRKBB,RAC-BETA |
| Fluorescent Reporter | Null |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | Null |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAAGACCGAGAGGCCGCGACCCAACACCTTTGTCATACGCTGCCTGCAGTGGACCACAGTCATCGAGAGGACCTTCCACGTGGATTCTCCAGACGAGAGGGAGGAGTGGATGCGGGCCATCCAGATGGTCGCCAACAGCCTCAAGCAGCGGGCCCCAGGCGAGGACCCCATGGACTACAAGTGTGGCTCCCCCAGTGACTCCTCCACGACTGAGGAGATGGAAGTGGCGGTCAGCAAGGCACGGGCTAAAGTGACCATGAATGACTTCGACTATCTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGCGGGAGAAGGCCACTGGCCGCTACTACGCCATGAAGATCCTGCGGAAGGAAGTCATCATTGCCAAGGATGAAGTCGCTCACACAGTCACCGAGAGCCGGGTCCTCCAGAACACCAGGCACCCGTTCCTCACTGCGCTGAAGTATGCCTTCCAGACCCACGACCGCCTGTGCTTTGTGATGGAGTATGCCAACGGGGGTGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTCTTCACAGAGGAGCGGGCCCGGTTTTATGGTGCAGAGATTGTCTCGGCTCTTGAGTACTTGCACTCGCGGGACGTGGTATACCGCGACATCAAGCTGGAAAACCTCATGCTGGACAAAGATGGCCACATCAAGATCACTGACTTTGGCCTCTGCAAAGAGGGCATCAGTGACGGGGCCACCATGAAAACCTTCTGTGGGACCCCGGAGTACCTGGCGCCTGAGGTGCTGGAGGACAATGACTATGGCCGGGCCGTGGACTGGTGGGGGCTGGGTGTGGTCATGTACGAGATGATGTGCGGCCGCCTGCCCTTCTACAACCAGGACCACGAGCGCCTCTTCGAGCTCATCCTCATGGAAGAGATCCGCTTCCCGCGCACGCTCAGCCCCGAGGCCAAGTCCCTGCTTGCTGGGCTGCTTAAGAAGGACCCCAAGCAGAGGCTTGGTGGGGGGCCCAGCGATGCCAAGGAGGTCATGGAGCACAGGTTCTTCCTCAGCATCAACTGGCAGGACGTGGTCCAGAAGAAGCTCCTGCCACCCTTCAAACCTCAGGTCACGTCCGAGGTCGACACAAGGTACTTCGATGATGAATTTACCGCCCAGTCCATCACAATCACACCCCCTGACCGCTATGACAGCCTGGGCTTACTGGAGCTGGACCAGCGGACCCACTTCCCCCAGTTCTCCTACTCGGCCAGCATCCGCGAGTGA |
| ORF Protein Sequence | MKTERPRPNTFVIRCLQWTTVIERTFHVDSPDEREEWMRAIQMVANSLKQRAPGEDPMDYKCGSPSDSSTTEEMEVAVSKARAKVTMNDFDYLKLLGKGTFGKVILVREKATGRYYAMKILRKEVIIAKDEVAHTVTESRVLQNTRHPFLTALKYAFQTHDRLCFVMEYANGGELFFHLSRERVFTEERARFYGAEIVSALEYLHSRDVVYRDIKLENLMLDKDGHIKITDFGLCKEGISDGATMKTFCGTPEYLAPEVLEDNDYGRAVDWWGLGVVMYEMMCGRLPFYNQDHERLFELILMEEIRFPRTLSPEAKSLLAGLLKKDPKQRLGGGPSDAKEVMEHRFFLSINWQDVVQKKLLPPFKPQVTSEVDTRYFDDEFTAQSITITPPDRYDSLGLLELDQRTHFPQFSYSASIRE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T94621-Ab | Anti-AKT2 monoclonal antibody |
| Target Antigen | GM-Tg-g-T94621-Ag | AKT2 protein |
| ORF Viral Vector | pGMLP005607 | Human AKT2 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000359 | Human AKT2 Lentivirus plasmid |
| ORF Viral Vector | vGMLP005607 | Human AKT2 Lentivirus particle |
| ORF Viral Vector | vGMLV000359 | Human AKT2 Lentivirus particle |
Target information
| Target ID | GM-T94621 |
| Target Name | AKT2 |
| Gene ID | 208, 11652, 700591, 25233, 100499544, 449021, 534923, 100064671 |
| Gene Symbol and Synonyms | 2410016A19Rik,AKT2,HIHGHH,PKB,PKBB,PKBBETA,PRKBB,RAC-BETA |
| Uniprot Accession | P31751 |
| Uniprot Entry Name | AKT2_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000105221 |
| Target Classification | Kinase, Tumor-associated antigen (TAA) |
This gene is a putative oncogene encoding a protein belonging to a subfamily of serine/threonine kinases containing SH2-like (Src homology 2-like) domains, which is involved in signaling pathways. The gene serves as an oncogene in the tumorigenesis of cancer cells For example, its overexpression contributes to the malignant phenotype of a subset of human ductal pancreatic cancers. The encoded protein is a general protein kinase capable of phophorylating several known proteins, and has also been implicated in insulin signaling. [provided by RefSeq, Nov 2019]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


