Human TARDBP/ALS10/TDP-43 ORF/cDNA clone-Lentivirus plasmid (NM_007375.3)

Cat. No.: pGMLV000576
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TARDBP/ALS10/TDP-43 Lentiviral expression plasmid for TARDBP lentivirus packaging, TARDBP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to TARDBP/ALS10 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $648.6
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000576
Gene Name TARDBP
Accession Number NM_007375.3
Gene ID 23435
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1245 bp
Gene Alias ALS10,TDP-43
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTGAATATATTCGGGTAACCGAAGATGAGAACGATGAGCCCATTGAAATACCATCGGAAGACGATGGGACGGTGCTGCTCTCCACGGTTACAGCCCAGTTTCCAGGGGCGTGTGGGCTTCGCTACAGGAATCCAGTGTCTCAGTGTATGAGAGGTGTCCGGCTGGTAGAAGGAATTCTGCATGCCCCAGATGCTGGCTGGGGAAATCTGGTGTATGTTGTCAACTATCCAAAAGATAACAAAAGAAAAATGGATGAGACAGATGCTTCATCAGCAGTGAAAGTGAAAAGAGCAGTCCAGAAAACATCCGATTTAATAGTGTTGGGTCTCCCATGGAAAACAACCGAACAGGACCTGAAAGAGTATTTTAGTACCTTTGGAGAAGTTCTTATGGTGCAGGTCAAGAAAGATCTTAAGACTGGTCATTCAAAGGGGTTTGGCTTTGTTCGTTTTACGGAATATGAAACACAAGTGAAAGTAATGTCACAGCGACATATGATAGATGGACGATGGTGTGACTGCAAACTTCCTAATTCTAAGCAAAGCCAAGATGAGCCTTTGAGAAGCAGAAAAGTGTTTGTGGGGCGCTGTACAGAGGACATGACTGAGGATGAGCTGCGGGAGTTCTTCTCTCAGTACGGGGATGTGATGGATGTCTTCATCCCCAAGCCATTCAGGGCCTTTGCCTTTGTTACATTTGCAGATGATCAGATTGCGCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTTCATATATCCAATGCCGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTTGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAATAGCAGAGGGGGTGGAGCTGGTTTGGGAAACAATCAAGGTAGTAATATGGGTGGTGGGATGAACTTTGGTGCGTTCAGCATTAATCCAGCCATGATGGCTGCCGCCCAGGCAGCACTACAGAGCAGTTGGGGTATGATGGGCATGTTAGCCAGCCAGCAGAACCAGTCAGGCCCATCGGGTAATAACCAAAACCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTCGGTTCTGGAAATAACTCTTATAGTGGCTCTAATTCTGGTGCAGCAATTGGTTGGGGATCAGCATCCAATGCAGGGTCGGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAGTCTTCTGGCTGGGGAATGTAG
ORF Protein Sequence MSEYIRVTEDENDEPIEIPSEDDGTVLLSTVTAQFPGACGLRYRNPVSQCMRGVRLVEGILHAPDAGWGNLVYVVNYPKDNKRKMDETDASSAVKVKRAVQKTSDLIVLGLPWKTTEQDLKEYFSTFGEVLMVQVKKDLKTGHSKGFGFVRFTEYETQVKVMSQRHMIDGRWCDCKLPNSKQSQDEPLRSRKVFVGRCTEDMTEDELREFFSQYGDVMDVFIPKPFRAFAFVTFADDQIAQSLCGEDLIIKGISVHISNAEPKHNSNRQLERSGRFGGNPGGFGNQGGFGNSRGGGAGLGNNQGSNMGGGMNFGAFSINPAMMAAAQAALQSSWGMMGMLASQQNQSGPSGNNQNQGNMQREPNQAFGSGNNSYSGSNSGAAIGWGSASNAGSGSGFNGGFGSSMDSKSSGWGM

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T08014-Ab Anti-TARDBP monoclonal antibody
    Target Antigen GM-Tg-g-T08014-Ag TARDBP protein
    ORF Viral Vector pGMLP002200 Human TARDBP Lentivirus plasmid
    ORF Viral Vector pGMLV000575 Human TDP-43-mu Lentivirus plasmid
    ORF Viral Vector pGMLV000576 Human TARDBP Lentivirus plasmid
    ORF Viral Vector vGMLP002200 Human TARDBP Lentivirus particle
    ORF Viral Vector vGMLV000575 Human TDP-43-mu Lentivirus particle
    ORF Viral Vector vGMLV000576 Human TARDBP Lentivirus particle


    Target information

    Target ID GM-T08014
    Target Name TARDBP
    Gene ID 23435, 230908, 100423163, 298648, 101097257, 478234, 540632, 100051482
    Gene Symbol and Synonyms 1190002A23Rik,ALS10,TARDBP,TDP-43,Tdp43
    Uniprot Accession Q13148
    Uniprot Entry Name TADBP_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000120948
    Target Classification Not Available

    HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. The protein encoded by this gene is a transcriptional repressor that binds to chromosomally integrated TAR DNA and represses HIV-1 transcription. In addition, this protein regulates alternate splicing of the CFTR gene. A similar pseudogene is present on chromosome 20. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.